From 64ca0ba6e91249d911010ef22fb3ec9ccd84bba7 Mon Sep 17 00:00:00 2001 From: Guillaume Pinot Date: Thu, 12 Dec 2013 12:26:56 +0100 Subject: [PATCH] rewrite of shootout-fasta.rs improvements: - no managed box - no virtual calls - no useless copy - optimizations (bisect is slower, limit tests, BufferedWriter...) - pass shootout test - should be as fast as the best official test Thanks to @cmr and @eddyb for their help! --- src/test/bench/shootout-fasta.rs | 200 +++++++++++++------------------ 1 file changed, 84 insertions(+), 116 deletions(-) diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs index 098512e95491..50138562fa31 100644 --- a/src/test/bench/shootout-fasta.rs +++ b/src/test/bench/shootout-fasta.rs @@ -8,148 +8,116 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -#[feature(managed_boxes)]; - /* -*- mode: rust; indent-tabs-mode: nil -*- * Implementation of 'fasta' benchmark from * Computer Language Benchmarks Game * http://shootout.alioth.debian.org/ */ -extern mod extra; -use std::int; use std::io; +use std::io::buffered::BufferedWriter; use std::io::File; +use std::num::min; use std::os; -use std::rand::Rng; -use std::rand; -use std::str; -static LINE_LENGTH: uint = 60u; +static LINE_LENGTH: uint = 60; +static IM: u32 = 139968; struct MyRandom { last: u32 } - -fn myrandom_next(r: @mut MyRandom, mx: u32) -> u32 { - r.last = (r.last * 3877u32 + 29573u32) % 139968u32; - mx * r.last / 139968u32 -} - -#[deriving(Clone)] -struct AminoAcids { - ch: char, - prob: u32 -} - -fn make_cumulative(aa: ~[AminoAcids]) -> ~[AminoAcids] { - let mut cp: u32 = 0u32; - let mut ans: ~[AminoAcids] = ~[]; - for a in aa.iter() { - cp += a.prob; - ans.push(AminoAcids {ch: a.ch, prob: cp}); +impl MyRandom { + fn new() -> MyRandom { MyRandom { last: 42 } } + fn normalize(p: f32) -> u32 {(p * IM as f32).floor() as u32} + fn gen(&mut self) -> u32 { + self.last = (self.last * 3877 + 29573) % IM; + self.last } - ans } -fn select_random(r: u32, genelist: ~[AminoAcids]) -> char { - if r < genelist[0].prob { return genelist[0].ch; } - fn bisect(v: ~[AminoAcids], lo: uint, hi: uint, target: u32) -> char { - if hi > lo + 1u { - let mid: uint = lo + (hi - lo) / 2u; - if target < v[mid].prob { - return bisect(v, lo, mid, target); - } else { - return bisect(v, mid, hi, target); - } - } else { - return v[hi].ch; +struct AAGen<'a> { + rng: &'a mut MyRandom, + data: ~[(u32, u8)] +} +impl<'a> AAGen<'a> { + fn new<'b>(rng: &'b mut MyRandom, aa: &[(char, f32)]) -> AAGen<'b> { + let mut cum = 0.; + let data = aa.iter() + .map(|&(ch, p)| { cum += p; (MyRandom::normalize(cum), ch as u8) }) + .collect(); + AAGen { rng: rng, data: data } + } +} +impl<'a> Iterator for AAGen<'a> { + fn next(&mut self) -> Option { + let r = self.rng.gen(); + self.data.iter() + .skip_while(|pc| pc.n0() < r) + .map(|&(_, c)| c) + .next() + } +} + +fn make_fasta>( + wr: &mut W, header: &str, mut it: I, mut n: uint) +{ + wr.write(header.as_bytes()); + let mut line = [0u8, .. LINE_LENGTH + 1]; + while n > 0 { + let nb = min(LINE_LENGTH, n); + for i in range(0, nb) { + line[i] = it.next().unwrap(); } + n -= nb; + line[nb] = '\n' as u8; + wr.write(line.slice_to(nb + 1)); } - bisect(genelist.clone(), 0, genelist.len() - 1, r) } -fn make_random_fasta(wr: @mut io::Writer, - id: ~str, - desc: ~str, - genelist: ~[AminoAcids], - n: int) { - writeln!(wr, ">{} {}", id, desc); - let mut rng = rand::rng(); - let rng = @mut MyRandom { - last: rng.gen() +fn run(writer: &mut W) { + let args = os::args(); + let n = if os::getenv("RUST_BENCH").is_some() { + 25000000 + } else if args.len() <= 1u { + 1000 + } else { + from_str(args[1]).unwrap() }; - let mut op: ~str = ~""; - for _ in range(0u, n as uint) { - op.push_char(select_random(myrandom_next(rng, 100u32), - genelist.clone())); - if op.len() >= LINE_LENGTH { - writeln!(wr, "{}", op); - op = ~""; - } - } - if op.len() > 0u { writeln!(wr, "{}", op); } -} -fn make_repeat_fasta(wr: @mut io::Writer, id: ~str, desc: ~str, s: ~str, n: int) { - writeln!(wr, ">{} {}", id, desc); - let mut op = str::with_capacity( LINE_LENGTH ); - let sl = s.len(); - for i in range(0u, n as uint) { - if (op.len() >= LINE_LENGTH) { - writeln!(wr, "{}", op); - op = str::with_capacity( LINE_LENGTH ); - } - op.push_char( s[i % sl] as char ); - } - if op.len() > 0 { - writeln!(wr, "{}", op); - } -} + let rng = &mut MyRandom::new(); + let alu = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ + GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ + CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ + ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ + GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ + AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ + AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + let iub = &[('a', 0.27), ('c', 0.12), ('g', 0.12), + ('t', 0.27), ('B', 0.02), ('D', 0.02), + ('H', 0.02), ('K', 0.02), ('M', 0.02), + ('N', 0.02), ('R', 0.02), ('S', 0.02), + ('V', 0.02), ('W', 0.02), ('Y', 0.02)]; + let homosapiens = &[('a', 0.3029549426680), + ('c', 0.1979883004921), + ('g', 0.1975473066391), + ('t', 0.3015094502008)]; -fn acid(ch: char, prob: u32) -> AminoAcids { - AminoAcids {ch: ch, prob: prob} + make_fasta(writer, ">ONE Homo sapiens alu\n", + alu.as_bytes().iter().cycle().map(|c| *c), n * 2); + make_fasta(writer, ">TWO IUB ambiguity codes\n", + AAGen::new(rng, iub), n * 3); + make_fasta(writer, ">THREE Homo sapiens frequency\n", + AAGen::new(rng, homosapiens), n * 5); + + writer.flush(); } fn main() { - let args = os::args(); - let args = if os::getenv("RUST_BENCH").is_some() { - // alioth tests k-nucleotide with this data at 25,000,000 - ~[~"", ~"5000000"] - } else if args.len() <= 1u { - ~[~"", ~"1000"] + if os::getenv("RUST_BENCH").is_some() { + let mut file = BufferedWriter::new(File::create(&Path::new("./shootout-fasta.data"))); + run(&mut file); } else { - args - }; - - let writer = if os::getenv("RUST_BENCH").is_some() { - let file = File::create(&Path::new("./shootout-fasta.data")); - @mut file as @mut io::Writer - } else { - @mut io::stdout() as @mut io::Writer - }; - - let n = from_str::(args[1]).unwrap(); - - let iub: ~[AminoAcids] = - make_cumulative(~[acid('a', 27u32), acid('c', 12u32), acid('g', 12u32), - acid('t', 27u32), acid('B', 2u32), acid('D', 2u32), - acid('H', 2u32), acid('K', 2u32), acid('M', 2u32), - acid('N', 2u32), acid('R', 2u32), acid('S', 2u32), - acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]); - let homosapiens: ~[AminoAcids] = - make_cumulative(~[acid('a', 30u32), acid('c', 20u32), acid('g', 20u32), - acid('t', 30u32)]); - let alu: ~str = - ~"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ - GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ - CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ - ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ - GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ - AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ - AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; - make_repeat_fasta(writer, ~"ONE", ~"Homo sapiens alu", alu, n * 2); - make_random_fasta(writer, ~"TWO", ~"IUB ambiguity codes", iub, n * 3); - make_random_fasta(writer, ~"THREE", - ~"Homo sapiens frequency", homosapiens, n * 5); + run(&mut BufferedWriter::new(io::stdout())); + } }