From fbbc1a77d242fafa1393127defa7ffec0bcb9e54 Mon Sep 17 00:00:00 2001 From: Graydon Hoare Date: Mon, 16 May 2011 18:21:22 -0700 Subject: [PATCH] Rewrite everything to use [] instead of vec() in value position. --- src/comp/back/upcall.rs | 82 +- src/comp/back/x86.rs | 80 +- src/comp/driver/rustc.rs | 44 +- src/comp/front/codemap.rs | 4 +- src/comp/front/creader.rs | 36 +- src/comp/front/eval.rs | 10 +- src/comp/front/extfmt.rs | 22 +- src/comp/front/lexer.rs | 12 +- src/comp/front/parser.rs | 78 +- src/comp/lib/llvm.rs | 6 +- src/comp/middle/fold.rs | 74 +- src/comp/middle/metadata.rs | 40 +- src/comp/middle/resolve.rs | 4 +- src/comp/middle/trans.rs | 928 +++++++++--------- src/comp/middle/ty.rs | 92 +- src/comp/middle/type_glue.rs | 16 +- src/comp/middle/typeck.rs | 140 +-- src/comp/middle/typestate_check.rs | 68 +- src/comp/pretty/pp.rs | 12 +- src/comp/pretty/pprust.rs | 4 +- src/comp/util/interner.rs | 4 +- src/lib/_str.rs | 12 +- src/lib/_vec.rs | 34 +- src/lib/bitv.rs | 2 +- src/lib/ebml.rs | 20 +- src/lib/extfmt.rs | 14 +- src/lib/fs.rs | 2 +- src/lib/getopts.rs | 10 +- src/lib/io.rs | 18 +- src/lib/linux_os.rs | 4 +- src/lib/macos_os.rs | 4 +- src/lib/posix_fs.rs | 2 +- src/lib/run_program.rs | 10 +- src/lib/sha1.rs | 4 +- src/lib/sort.rs | 6 +- src/lib/term.rs | 8 +- src/lib/ufind.rs | 4 +- src/lib/win32_os.rs | 2 +- src/snapshots.txt | 5 +- src/test/bench/shootout/fasta.rs | 12 +- src/test/bench/shootout/nbody.rs | 8 +- .../infinite-vec-type-recursion.rs | 2 +- .../compile-fail/writing-to-immutable-vec.rs | 2 +- src/test/run-fail/vec-overrun.rs | 2 +- src/test/run-fail/vec-underrun.rs | 2 +- src/test/run-pass/alt-join.rs | 4 +- src/test/run-pass/argv.rs | 4 +- src/test/run-pass/break.rs | 4 +- src/test/run-pass/empty-mutable-vec.rs | 2 +- src/test/run-pass/expr-alt-generic-box2.rs | 2 +- src/test/run-pass/expr-block-generic-box2.rs | 2 +- src/test/run-pass/expr-if-generic-box2.rs | 2 +- src/test/run-pass/foreach-nested-2.rs | 2 +- src/test/run-pass/foreach-nested.rs | 2 +- src/test/run-pass/integral-indexing.rs | 2 +- src/test/run-pass/lib-bitv.rs | 86 +- src/test/run-pass/lib-io.rs | 2 +- src/test/run-pass/lib-qsort.rs | 20 +- src/test/run-pass/lib-sha1.rs | 28 +- src/test/run-pass/lib-sort.rs | 20 +- src/test/run-pass/lib-str.rs | 12 +- src/test/run-pass/lib-vec.rs | 8 +- src/test/run-pass/linear-for-loop.rs | 2 +- src/test/run-pass/maybe-mutable.rs | 4 +- src/test/run-pass/mutable-alias-vec.rs | 4 +- src/test/run-pass/mutable-vec-drop.rs | 2 +- src/test/run-pass/obj-with-vec.rs | 2 +- src/test/run-pass/seq-compare.rs | 18 +- src/test/run-pass/size-and-align.rs | 2 +- src/test/run-pass/task-comm-16.rs | 2 +- src/test/run-pass/task-comm-2.rs | 6 +- src/test/run-pass/task-comm-3.rs | 8 +- src/test/run-pass/task-comm.rs | 14 +- src/test/run-pass/type-params-in-for-each.rs | 2 +- src/test/run-pass/utf8_chars.rs | 8 +- src/test/run-pass/vec-alloc-append.rs | 2 +- src/test/run-pass/vec-append.rs | 12 +- src/test/run-pass/vec-concat.rs | 4 +- src/test/run-pass/vec-drop.rs | 2 +- src/test/run-pass/vec-growth.rs | 10 +- src/test/run-pass/vec-in-tup.rs | 4 +- src/test/run-pass/vec-late-init.rs | 4 +- src/test/run-pass/vec-push.rs | 4 +- src/test/run-pass/vec-ref-count.rs | 2 +- src/test/run-pass/vec-slice.rs | 2 +- src/test/run-pass/vec.rs | 2 +- src/test/run-pass/while-with-break.rs | 2 +- 87 files changed, 1137 insertions(+), 1134 deletions(-) diff --git a/src/comp/back/upcall.rs b/src/comp/back/upcall.rs index c4abeec176e4..b1b533c84d6a 100644 --- a/src/comp/back/upcall.rs +++ b/src/comp/back/upcall.rs @@ -63,8 +63,8 @@ type upcalls = rec( fn declare_upcalls(type_names tn, ModuleRef llmod) -> @upcalls { fn decl(type_names tn, ModuleRef llmod, str name, vec[TypeRef] tys, TypeRef rv) -> ValueRef { - let vec[TypeRef] arg_tys = vec(T_taskptr(tn)); - for (TypeRef t in tys) { arg_tys += vec(t); } + let vec[TypeRef] arg_tys = [T_taskptr(tn)]; + for (TypeRef t in tys) { arg_tys += [t]; } auto fn_ty = T_fn(arg_tys, rv); ret trans::decl_cdecl_fn(llmod, "upcall_" + name, fn_ty); } @@ -74,61 +74,61 @@ fn declare_upcalls(type_names tn, ModuleRef llmod) -> @upcalls { // FIXME: Sigh:.. remove this when I fix the typechecker pushdown. // --pcwalton - let vec[TypeRef] empty_vec = vec(); + let vec[TypeRef] empty_vec = []; ret @rec( - grow_task=dv("grow_task", vec(T_size_t())), - log_int=dv("log_int", vec(T_i32(), T_i32())), - log_float=dv("log_float", vec(T_i32(), T_f32())), - log_double=dv("log_double", vec(T_i32(), T_ptr(T_f64()))), - log_str=dv("log_str", vec(T_i32(), T_ptr(T_str()))), - trace_word=dv("trace_word", vec(T_int())), - trace_str=dv("trace_str", vec(T_ptr(T_i8()))), - new_port=d("new_port", vec(T_size_t()), T_opaque_port_ptr()), - del_port=dv("del_port", vec(T_opaque_port_ptr())), - new_chan=d("new_chan", vec(T_opaque_port_ptr()), T_opaque_chan_ptr()), - flush_chan=dv("flush_chan", vec(T_opaque_chan_ptr())), - del_chan=dv("del_chan", vec(T_opaque_chan_ptr())), - clone_chan=d("clone_chan", vec(T_taskptr(tn), T_opaque_chan_ptr()), + grow_task=dv("grow_task", [T_size_t()]), + log_int=dv("log_int", [T_i32(), T_i32()]), + log_float=dv("log_float", [T_i32(), T_f32()]), + log_double=dv("log_double", [T_i32(), T_ptr(T_f64())]), + log_str=dv("log_str", [T_i32(), T_ptr(T_str())]), + trace_word=dv("trace_word", [T_int()]), + trace_str=dv("trace_str", [T_ptr(T_i8())]), + new_port=d("new_port", [T_size_t()], T_opaque_port_ptr()), + del_port=dv("del_port", [T_opaque_port_ptr()]), + new_chan=d("new_chan", [T_opaque_port_ptr()], T_opaque_chan_ptr()), + flush_chan=dv("flush_chan", [T_opaque_chan_ptr()]), + del_chan=dv("del_chan", [T_opaque_chan_ptr()]), + clone_chan=d("clone_chan", [T_taskptr(tn), T_opaque_chan_ptr()], T_opaque_chan_ptr()), _yield=dv("yield", empty_vec), - sleep=dv("sleep", vec(T_size_t())), - _join=dv("join", vec(T_taskptr(tn))), - send=dv("send", vec(T_opaque_chan_ptr(), T_ptr(T_i8()))), - recv=dv("recv", vec(T_ptr(T_ptr(T_i8())), T_opaque_port_ptr())), - _fail=dv("fail", vec(T_ptr(T_i8()), T_ptr(T_i8()), T_size_t())), - kill=dv("kill", vec(T_taskptr(tn))), + sleep=dv("sleep", [T_size_t()]), + _join=dv("join", [T_taskptr(tn)]), + send=dv("send", [T_opaque_chan_ptr(), T_ptr(T_i8())]), + recv=dv("recv", [T_ptr(T_ptr(T_i8())), T_opaque_port_ptr()]), + _fail=dv("fail", [T_ptr(T_i8()), T_ptr(T_i8()), T_size_t()]), + kill=dv("kill", [T_taskptr(tn)]), exit=dv("exit", empty_vec), - malloc=d("malloc", vec(T_size_t(), T_ptr(T_tydesc(tn))), + malloc=d("malloc", [T_size_t(), T_ptr(T_tydesc(tn))], T_ptr(T_i8())), - free=dv("free", vec(T_ptr(T_i8()), T_int())), - mark=d("mark", vec(T_ptr(T_i8())), T_int()), - new_str=d("new_str", vec(T_ptr(T_i8()), T_size_t()), T_ptr(T_str())), - new_vec=d("new_vec", vec(T_size_t(), T_ptr(T_tydesc(tn))), + free=dv("free", [T_ptr(T_i8()), T_int()]), + mark=d("mark", [T_ptr(T_i8())], T_int()), + new_str=d("new_str", [T_ptr(T_i8()), T_size_t()], T_ptr(T_str())), + new_vec=d("new_vec", [T_size_t(), T_ptr(T_tydesc(tn))], T_opaque_vec_ptr()), - vec_grow=d("vec_grow", vec(T_opaque_vec_ptr(), T_size_t(), - T_ptr(T_int()), T_ptr(T_tydesc(tn))), + vec_grow=d("vec_grow", [T_opaque_vec_ptr(), T_size_t(), + T_ptr(T_int()), T_ptr(T_tydesc(tn))], T_opaque_vec_ptr()), require_rust_sym=d("require_rust_sym", - vec(T_ptr(T_crate(tn)), T_size_t(), T_size_t(), + [T_ptr(T_crate(tn)), T_size_t(), T_size_t(), T_size_t(), T_ptr(T_i8()), - T_ptr(T_ptr(T_i8()))), + T_ptr(T_ptr(T_i8()))], T_int()), require_c_sym=d("require_c_sym", - vec(T_ptr(T_crate(tn)), T_size_t(), T_size_t(), - T_ptr(T_i8()), T_ptr(T_i8())), + [T_ptr(T_crate(tn)), T_size_t(), T_size_t(), + T_ptr(T_i8()), T_ptr(T_i8())], T_int()), get_type_desc=d("get_type_desc", - vec(T_ptr(T_crate(tn)), T_size_t(), T_size_t(), - T_size_t(), T_ptr(T_ptr(T_tydesc(tn)))), + [T_ptr(T_crate(tn)), T_size_t(), T_size_t(), + T_size_t(), T_ptr(T_ptr(T_tydesc(tn)))], T_ptr(T_tydesc(tn))), - new_task=d("new_task", vec(T_ptr(T_i8())), T_taskptr(tn)), - start_task=d("start_task", vec(T_taskptr(tn), T_int(), T_int(), - T_int(), T_size_t()), + new_task=d("new_task", [T_ptr(T_i8())], T_taskptr(tn)), + start_task=d("start_task", [T_taskptr(tn), T_int(), T_int(), + T_int(), T_size_t()], T_taskptr(tn)), - new_thread=d("new_thread", vec(T_ptr(T_i8())), T_taskptr(tn)), - start_thread=d("start_thread", vec(T_taskptr(tn), T_int(), T_int(), - T_int(), T_size_t()), + new_thread=d("new_thread", [T_ptr(T_i8())], T_taskptr(tn)), + start_thread=d("start_thread", [T_taskptr(tn), T_int(), T_int(), + T_int(), T_size_t()], T_taskptr(tn)) ); } diff --git a/src/comp/back/x86.rs b/src/comp/back/x86.rs index 7d578c2f8d58..fffb82053f67 100644 --- a/src/comp/back/x86.rs +++ b/src/comp/back/x86.rs @@ -12,78 +12,78 @@ fn wstr(int i) -> str { } fn start() -> vec[str] { - ret vec(".cfi_startproc"); + ret [".cfi_startproc"]; } fn end() -> vec[str] { - ret vec(".cfi_endproc"); + ret [".cfi_endproc"]; } fn save_callee_saves() -> vec[str] { - ret vec("pushl %ebp", + ret ["pushl %ebp", "pushl %edi", "pushl %esi", - "pushl %ebx"); + "pushl %ebx"]; } fn save_callee_saves_with_cfi() -> vec[str] { auto offset = 8; auto t; - t = vec("pushl %ebp"); - t += vec(".cfi_def_cfa_offset " + istr(offset)); - t += vec(".cfi_offset %ebp, -" + istr(offset)); + t = ["pushl %ebp"]; + t += [".cfi_def_cfa_offset " + istr(offset)]; + t += [".cfi_offset %ebp, -" + istr(offset)]; - t += vec("pushl %edi"); + t += ["pushl %edi"]; offset += 4; - t += vec(".cfi_def_cfa_offset " + istr(offset)); + t += [".cfi_def_cfa_offset " + istr(offset)]; - t += vec("pushl %esi"); + t += ["pushl %esi"]; offset += 4; - t += vec(".cfi_def_cfa_offset " + istr(offset)); + t += [".cfi_def_cfa_offset " + istr(offset)]; - t += vec("pushl %ebx"); + t += ["pushl %ebx"]; offset += 4; - t += vec(".cfi_def_cfa_offset " + istr(offset)); + t += [".cfi_def_cfa_offset " + istr(offset)]; ret t; } fn restore_callee_saves() -> vec[str] { - ret vec("popl %ebx", + ret ["popl %ebx", "popl %esi", "popl %edi", - "popl %ebp"); + "popl %ebp"]; } fn load_esp_from_rust_sp_first_arg() -> vec[str] { - ret vec("movl " + wstr(abi::task_field_rust_sp) + "(%ecx), %esp"); + ret ["movl " + wstr(abi::task_field_rust_sp) + "(%ecx), %esp"]; } fn load_esp_from_runtime_sp_first_arg() -> vec[str] { - ret vec("movl " + wstr(abi::task_field_runtime_sp) + "(%ecx), %esp"); + ret ["movl " + wstr(abi::task_field_runtime_sp) + "(%ecx), %esp"]; } fn store_esp_to_rust_sp_first_arg() -> vec[str] { - ret vec("movl %esp, " + wstr(abi::task_field_rust_sp) + "(%ecx)"); + ret ["movl %esp, " + wstr(abi::task_field_rust_sp) + "(%ecx)"]; } fn store_esp_to_runtime_sp_first_arg() -> vec[str] { - ret vec("movl %esp, " + wstr(abi::task_field_runtime_sp) + "(%ecx)"); + ret ["movl %esp, " + wstr(abi::task_field_runtime_sp) + "(%ecx)"]; } fn load_esp_from_rust_sp_second_arg() -> vec[str] { - ret vec("movl " + wstr(abi::task_field_rust_sp) + "(%edx), %esp"); + ret ["movl " + wstr(abi::task_field_rust_sp) + "(%edx), %esp"]; } fn load_esp_from_runtime_sp_second_arg() -> vec[str] { - ret vec("movl " + wstr(abi::task_field_runtime_sp) + "(%edx), %esp"); + ret ["movl " + wstr(abi::task_field_runtime_sp) + "(%edx), %esp"]; } fn store_esp_to_rust_sp_second_arg() -> vec[str] { - ret vec("movl %esp, " + wstr(abi::task_field_rust_sp) + "(%edx)"); + ret ["movl %esp, " + wstr(abi::task_field_rust_sp) + "(%edx)"]; } fn store_esp_to_runtime_sp_second_arg() -> vec[str] { - ret vec("movl %esp, " + wstr(abi::task_field_runtime_sp) + "(%edx)"); + ret ["movl %esp, " + wstr(abi::task_field_runtime_sp) + "(%edx)"]; } @@ -105,7 +105,7 @@ fn store_esp_to_runtime_sp_second_arg() -> vec[str] { */ fn rust_activate_glue() -> vec[str] { - ret vec("movl 4(%esp), %ecx # ecx = rust_task") + ret ["movl 4(%esp), %ecx # ecx = rust_task"] + save_callee_saves() + store_esp_to_runtime_sp_first_arg() + load_esp_from_rust_sp_first_arg() @@ -157,7 +157,7 @@ fn rust_activate_glue() -> vec[str] { * will be a no-op. Esp won't move, and the task's stack won't * grow. */ - + vec("addl $20, " + wstr(abi::task_field_rust_sp) + "(%ecx)") + + ["addl $20, " + wstr(abi::task_field_rust_sp) + "(%ecx)"] /* @@ -167,10 +167,10 @@ fn rust_activate_glue() -> vec[str] { * activating, the task needs to be in the fastcall 2nd parameter * expected by the rust main function. That's edx. */ - + vec("mov %ecx, %edx") + + ["mov %ecx, %edx"] + restore_callee_saves() - + vec("ret"); + + ["ret"]; } /* More glue code, this time the 'bottom half' of yielding. @@ -200,13 +200,13 @@ fn rust_activate_glue() -> vec[str] { */ fn rust_yield_glue() -> vec[str] { - ret vec("movl 0(%esp), %ecx # ecx = rust_task") + ret ["movl 0(%esp), %ecx # ecx = rust_task"] + load_esp_from_rust_sp_first_arg() + save_callee_saves() + store_esp_to_rust_sp_first_arg() + load_esp_from_runtime_sp_first_arg() + restore_callee_saves() - + vec("ret"); + + ["ret"]; } fn native_glue(int n_args, abi::native_glue_type ngt) -> vec[str] { @@ -239,8 +239,8 @@ fn native_glue(int n_args, abi::native_glue_type ngt) -> vec[str] { } else { src_off = wstr(5 + (i as int)); } - auto m = vec("movl " + src_off + "(%ebp),%eax", - "movl %eax," + dst_off + "(%esp)"); + auto m = ["movl " + src_off + "(%ebp),%eax", + "movl %eax," + dst_off + "(%esp)"]; ret _str::connect(m, "\n\t"); } @@ -250,24 +250,24 @@ fn native_glue(int n_args, abi::native_glue_type ngt) -> vec[str] { start() + save_callee_saves_with_cfi() - + vec("movl %esp, %ebp # ebp = rust_sp") - + vec(".cfi_def_cfa_register %ebp") + + ["movl %esp, %ebp # ebp = rust_sp"] + + [".cfi_def_cfa_register %ebp"] + store_esp_to_rust_sp_second_arg() + load_esp_from_runtime_sp_second_arg() - + vec("subl $" + wstr(n_args) + ", %esp # esp -= args", - "andl $~0xf, %esp # align esp down") + + ["subl $" + wstr(n_args) + ", %esp # esp -= args", + "andl $~0xf, %esp # align esp down"] + _vec::init_fn[str](carg, (n_args) as uint) - + vec("movl %edx, %edi # save task from edx to edi", + + ["movl %edx, %edi # save task from edx to edi", "call *%ecx # call *%ecx", - "movl %edi, %edx # restore edi-saved task to edx") + "movl %edi, %edx # restore edi-saved task to edx"] + load_esp_from_rust_sp_second_arg() + restore_callee_saves() - + vec("ret") + + ["ret"] + end(); } @@ -305,13 +305,13 @@ fn get_module_asm() -> str { auto prefix = get_symbol_prefix(); auto glues = - vec(decl_glue(align, prefix, + [decl_glue(align, prefix, abi::activate_glue_name(), rust_activate_glue()), decl_glue(align, prefix, abi::yield_glue_name(), - rust_yield_glue())) + rust_yield_glue())] + _vec::init_fn[str](bind decl_native_glue(align, prefix, abi::ngt_rust, _), (abi::n_native_glues + 1) as uint) diff --git a/src/comp/driver/rustc.rs b/src/comp/driver/rustc.rs index d538e1711a63..f2f082323fac 100644 --- a/src/comp/driver/rustc.rs +++ b/src/comp/driver/rustc.rs @@ -44,7 +44,7 @@ fn default_environment(session::session sess, } ret - vec( + [ // Target bindings. tup("target_os", eval::val_str(std::os::target_os())), tup("target_arch", eval::val_str("x86")), @@ -53,7 +53,7 @@ fn default_environment(session::session sess, // Build bindings. tup("build_compiler", eval::val_str(argv0)), tup("build_input", eval::val_str(input)) - ); + ]; } fn parse_input(session::session sess, @@ -205,7 +205,7 @@ fn main(vec[str] args) { uint_type = common::ty_u32, float_type = common::ty_f64); - auto opts = vec(optflag("h"), optflag("help"), + auto opts = [optflag("h"), optflag("help"), optflag("v"), optflag("version"), optflag("glue"), optflag("emit-llvm"), optflag("pretty"), optflag("ls"), optflag("parse-only"), @@ -214,7 +214,7 @@ fn main(vec[str] args) { optflag("save-temps"), optopt("sysroot"), optflag("stats"), optflag("time-passes"), optflag("time-llvm-passes"), - optflag("no-typestate"), optflag("noverify")); + optflag("no-typestate"), optflag("noverify")]; auto binary = _vec::shift[str](args); auto match; alt (getopts::getopts(args, opts)) { @@ -287,7 +287,7 @@ fn main(vec[str] args) { auto crate_cache = common::new_int_hash[session::crate_metadata](); auto target_crate_num = 0; - let vec[@ast::meta_item] md = vec(); + let vec[@ast::meta_item] md = []; auto sess = session::session(target_crate_num, target_cfg, sopts, crate_cache, md, front::codemap::new_codemap()); @@ -323,13 +323,13 @@ fn main(vec[str] args) { _vec::pop[str](parts); saved_out_filename = parts.(0); alt (output_type) { - case (link::output_type_none) { parts += vec("pp"); } - case (link::output_type_bitcode) { parts += vec("bc"); } - case (link::output_type_assembly) { parts += vec("s"); } + case (link::output_type_none) { parts += ["pp"]; } + case (link::output_type_bitcode) { parts += ["bc"]; } + case (link::output_type_assembly) { parts += ["s"]; } // Object and exe output both use the '.o' extension here - case (link::output_type_object) { parts += vec("o"); } - case (link::output_type_exe) { parts += vec("o"); } + case (link::output_type_object) { parts += ["o"]; } + case (link::output_type_exe) { parts += ["o"]; } } auto ofile = _str::connect(parts, "."); compile_input(sess, env, ifile, ofile); @@ -353,33 +353,33 @@ fn main(vec[str] args) { let str exe_suffix = ""; // The invocations of gcc share some flags across platforms - let vec[str] common_cflags = vec("-fno-strict-aliasing", "-fPIC", - "-Wall", "-fno-rtti", "-fno-exceptions", "-g"); - let vec[str] common_libs = vec(stage, "-Lrustllvm", "-Lrt", - "-lrustrt", "-lrustllvm", "-lstd", "-lm"); + let vec[str] common_cflags = ["-fno-strict-aliasing", "-fPIC", + "-Wall", "-fno-rtti", "-fno-exceptions", "-g"]; + let vec[str] common_libs = [stage, "-Lrustllvm", "-Lrt", + "-lrustrt", "-lrustllvm", "-lstd", "-lm"]; alt (sess.get_targ_cfg().os) { case (session::os_win32) { exe_suffix = ".exe"; - gcc_args = common_cflags + vec( + gcc_args = common_cflags + [ "-march=i686", "-O2", glu, "-o", saved_out_filename + exe_suffix, - saved_out_filename + ".o") + common_libs; + saved_out_filename + ".o"] + common_libs; } case (session::os_macos) { - gcc_args = common_cflags + vec( + gcc_args = common_cflags + [ "-arch i386", "-O0", "-m32", glu, "-o", saved_out_filename + exe_suffix, - saved_out_filename + ".o") + common_libs; + saved_out_filename + ".o"] + common_libs; } case (session::os_linux) { - gcc_args = common_cflags + vec( + gcc_args = common_cflags + [ "-march=i686", "-O2", "-m32", glu, "-o", saved_out_filename + exe_suffix, - saved_out_filename + ".o") + common_libs; + saved_out_filename + ".o"] + common_libs; } } @@ -388,12 +388,12 @@ fn main(vec[str] args) { // Clean up on Darwin if (sess.get_targ_cfg().os == session::os_macos) { - run::run_program("dsymutil", vec(saved_out_filename)); + run::run_program("dsymutil", [saved_out_filename]); } // Remove the temporary object file if we aren't saving temps if (!save_temps) { - run::run_program("rm", vec(saved_out_filename + ".o")); + run::run_program("rm", [saved_out_filename + ".o"]); } } } diff --git a/src/comp/front/codemap.rs b/src/comp/front/codemap.rs index c474fa07fb67..cd959d9d88de 100644 --- a/src/comp/front/codemap.rs +++ b/src/comp/front/codemap.rs @@ -13,14 +13,14 @@ type codemap = @rec(mutable vec[filemap] files); type loc = rec(str filename, uint line, uint col); fn new_codemap() -> codemap { - let vec[filemap] files = vec(); + let vec[filemap] files = []; ret @rec(mutable files=files); } fn new_filemap(str filename, uint start_pos) -> filemap { ret @rec(name=filename, start_pos=start_pos, - mutable lines=vec(0u)); + mutable lines=[0u]); } fn next_line(filemap file, uint pos) { diff --git a/src/comp/front/creader.rs b/src/comp/front/creader.rs index 023ede508659..3ac7b3638e1e 100644 --- a/src/comp/front/creader.rs +++ b/src/comp/front/creader.rs @@ -90,9 +90,9 @@ fn parse_ty(@pstate st, str_def sd) -> ty::t { case ('t') { assert (next(st) as char == '['); auto def = parse_def(st, sd); - let vec[ty::t] params = vec(); + let vec[ty::t] params = []; while (peek(st) as char != ']') { - params += vec(parse_ty(st, sd)); + params += [parse_ty(st, sd)]; } st.pos = st.pos + 1u; ret ty::mk_tag(st.tcx, def, params); @@ -104,23 +104,23 @@ fn parse_ty(@pstate st, str_def sd) -> ty::t { case ('C') { ret ty::mk_chan(st.tcx, parse_ty(st, sd)); } case ('T') { assert (next(st) as char == '['); - let vec[ty::mt] params = vec(); + let vec[ty::mt] params = []; while (peek(st) as char != ']') { - params += vec(parse_mt(st, sd)); + params += [parse_mt(st, sd)]; } st.pos = st.pos + 1u; ret ty::mk_tup(st.tcx, params); } case ('R') { assert (next(st) as char == '['); - let vec[ty::field] fields = vec(); + let vec[ty::field] fields = []; while (peek(st) as char != ']') { auto name = ""; while (peek(st) as char != '=') { name += _str::unsafe_from_byte(next(st)); } st.pos = st.pos + 1u; - fields += vec(rec(ident=name, mt=parse_mt(st, sd))); + fields += [rec(ident=name, mt=parse_mt(st, sd))]; } st.pos = st.pos + 1u; ret ty::mk_rec(st.tcx, fields); @@ -146,7 +146,7 @@ fn parse_ty(@pstate st, str_def sd) -> ty::t { } case ('O') { assert (next(st) as char == '['); - let vec[ty::method] methods = vec(); + let vec[ty::method] methods = []; while (peek(st) as char != ']') { auto proto; alt (next(st) as char) { @@ -158,10 +158,10 @@ fn parse_ty(@pstate st, str_def sd) -> ty::t { name += _str::unsafe_from_byte(next(st)); } auto func = parse_ty_fn(st, sd); - methods += vec(rec(proto=proto, + methods += [rec(proto=proto, ident=name, inputs=func._0, - output=func._1)); + output=func._1)]; } st.pos += 1u; ret ty::mk_obj(st.tcx, methods); @@ -242,14 +242,14 @@ fn parse_hex(@pstate st) -> uint { fn parse_ty_fn(@pstate st, str_def sd) -> tup(vec[ty::arg], ty::t) { assert (next(st) as char == '['); - let vec[ty::arg] inputs = vec(); + let vec[ty::arg] inputs = []; while (peek(st) as char != ']') { auto mode = ty::mo_val; if (peek(st) as char == '&') { mode = ty::mo_alias; st.pos = st.pos + 1u; } - inputs += vec(rec(mode=mode, ty=parse_ty(st, sd))); + inputs += [rec(mode=mode, ty=parse_ty(st, sd))]; } st.pos = st.pos + 1u; ret tup(inputs, parse_ty(st, sd)); @@ -285,7 +285,7 @@ fn lookup_hash(&ebml::doc d, fn(vec[u8]) -> bool eq_fn, uint hash) auto pos = ebml::be_uint_from_bytes(d.data, hash_pos, 4u); auto bucket = ebml::doc_at(d.data, pos); // Awkward logic because we can't ret from foreach yet - let vec[ebml::doc] result = vec(); + let vec[ebml::doc] result = []; auto belt = metadata::tag_index_buckets_bucket_elt; for each (ebml::doc elt in ebml::tagged_docs(bucket, belt)) { auto pos = ebml::be_uint_from_bytes(elt.data, elt.start, 4u); @@ -306,7 +306,7 @@ fn resolve_path(vec[ast::ident] path, vec[u8] data) -> vec[ast::def_id] { auto md = ebml::new_doc(data); auto paths = ebml::get_doc(md, metadata::tag_paths); auto eqer = bind eq_item(_, s); - let vec[ast::def_id] result = vec(); + let vec[ast::def_id] result = []; for (ebml::doc doc in lookup_hash(paths, eqer, metadata::hash_path(s))) { auto did_doc = ebml::get_doc(doc, metadata::tag_def_id); _vec::push(result, parse_def_id(ebml::doc_data(did_doc))); @@ -380,7 +380,7 @@ fn item_ty_param_count(&ebml::doc item, int this_cnum) -> uint { } fn tag_variant_ids(&ebml::doc item, int this_cnum) -> vec[ast::def_id] { - let vec[ast::def_id] ids = vec(); + let vec[ast::def_id] ids = []; auto v = metadata::tag_items_data_item_variant; for each (ebml::doc p in ebml::tagged_docs(item, v)) { auto ext = parse_def_id(ebml::doc_data(p)); @@ -544,23 +544,23 @@ fn get_tag_variants(session::session sess, ty::ctxt tcx, ast::def_id def) auto items = ebml::get_doc(ebml::new_doc(data), metadata::tag_items); auto item = find_item(def._1, items); - let vec[trans::variant_info] infos = vec(); + let vec[trans::variant_info] infos = []; auto variant_ids = tag_variant_ids(item, external_crate_id); for (ast::def_id did in variant_ids) { auto item = find_item(did._1, items); auto ctor_ty = item_type(item, external_crate_id, tcx); - let vec[ty::t] arg_tys = vec(); + let vec[ty::t] arg_tys = []; alt (ty::struct(tcx, ctor_ty)) { case (ty::ty_fn(_, ?args, _)) { for (ty::arg a in args) { - arg_tys += vec(a.ty); + arg_tys += [a.ty]; } } case (_) { // Nullary tag variant. } } - infos += vec(rec(args=arg_tys, ctor_ty=ctor_ty, id=did)); + infos += [rec(args=arg_tys, ctor_ty=ctor_ty, id=did)]; } ret infos; diff --git a/src/comp/front/eval.rs b/src/comp/front/eval.rs index 0416611c8f39..c44af3d0926b 100644 --- a/src/comp/front/eval.rs +++ b/src/comp/front/eval.rs @@ -38,7 +38,7 @@ type ctx = @rec(parser p, mutable uint next_ann); fn mk_env() -> env { - let env e = vec(); + let env e = []; ret e; } @@ -249,8 +249,8 @@ fn eval_crate_directives(ctx cx, fn eval_crate_directives_to_mod(ctx cx, env e, vec[@ast::crate_directive] cdirs, str prefix) -> ast::_mod { - let vec[@ast::view_item] view_items = vec(); - let vec[@ast::item] items = vec(); + let vec[@ast::view_item] view_items = []; + let vec[@ast::item] items = []; eval_crate_directives(cx, e, cdirs, prefix, view_items, items); @@ -356,7 +356,7 @@ fn eval_crate_directive(ctx cx, case (ast::cdir_let(?id, ?x, ?cdirs)) { auto v = eval_expr(cx, e, x); - auto e0 = vec(tup(id, v)) + e; + auto e0 = [tup(id, v)] + e; eval_crate_directives(cx, e0, cdirs, prefix, view_items, items); } @@ -379,7 +379,7 @@ fn eval_crate_directive(ctx cx, auto full_path = prefix + std::fs::path_sep() + file_path; if (cx.mode == mode_depend) { - cx.deps += vec(full_path); + cx.deps += [full_path]; ret; } diff --git a/src/comp/front/extfmt.rs b/src/comp/front/extfmt.rs index df1b5e67f0a3..9c15d11e4c43 100644 --- a/src/comp/front/extfmt.rs +++ b/src/comp/front/extfmt.rs @@ -118,7 +118,7 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args) fn make_path_expr(parser p, common::span sp, vec[ast::ident] idents) -> @ast::expr { - let vec[@ast::ty] types = vec(); + let vec[@ast::ty] types = []; auto path = rec(idents=idents, types=types); auto sp_path = rec(node=path, span=sp); auto pathexpr = ast::expr_path(sp_path, p.get_ann()); @@ -143,14 +143,14 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args) fn make_rec_expr(parser p, common::span sp, vec[tup(ast::ident, @ast::expr)] fields) -> @ast::expr { - let vec[ast::field] astfields = vec(); + let vec[ast::field] astfields = []; for (tup(ast::ident, @ast::expr) field in fields) { auto ident = field._0; auto val = field._1; auto astfield = rec(mut = ast::imm, ident = ident, expr = val); - astfields += vec(astfield); + astfields += [astfield]; } auto recexpr = ast::expr_rec(astfields, @@ -163,7 +163,7 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args) fn make_path_vec(str ident) -> vec[str] { // FIXME: #fmt can't currently be used from within std // because we're explicitly referencing the 'std' crate here - ret vec("std", "extfmt", "rt", ident); + ret ["std", "extfmt", "rt", ident]; } fn make_rt_path_expr(parser p, common::span sp, str ident) -> @ast::expr { @@ -177,7 +177,7 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args) fn make_flags(parser p, common::span sp, vec[flag] flags) -> @ast::expr { - let vec[@ast::expr] flagexprs = vec(); + let vec[@ast::expr] flagexprs = []; for (flag f in flags) { auto fstr; alt (f) { @@ -197,14 +197,14 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args) fstr = "flag_alternate"; } } - flagexprs += vec(make_rt_path_expr(p, sp, fstr)); + flagexprs += [make_rt_path_expr(p, sp, fstr)]; } // FIXME: 0-length vectors can't have their type inferred // through the rec that these flags are a member of, so // this is a hack placeholder flag if (_vec::len[@ast::expr](flagexprs) == 0u) { - flagexprs += vec(make_rt_path_expr(p, sp, "flag_none")); + flagexprs += [make_rt_path_expr(p, sp, "flag_none")]; } ret make_vec_expr(p, sp, flagexprs); @@ -218,7 +218,7 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args) case (count_is(?c)) { auto count_lit = make_new_int(p, sp, c); auto count_is_path = make_path_vec("count_is"); - auto count_is_args = vec(count_lit); + auto count_is_args = [count_lit]; ret make_call(p, sp, count_is_path, count_is_args); } case (_) { @@ -261,10 +261,10 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args) @ast::expr width_expr, @ast::expr precision_expr, @ast::expr ty_expr) -> @ast::expr { - ret make_rec_expr(p, sp, vec(tup("flags", flags_expr), + ret make_rec_expr(p, sp, [tup("flags", flags_expr), tup("width", width_expr), tup("precision", precision_expr), - tup("ty", ty_expr))); + tup("ty", ty_expr)]); } auto rt_conv_flags = make_flags(p, sp, cnv.flags); @@ -284,7 +284,7 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args) auto fname = "conv_" + conv_type; auto path = make_path_vec(fname); auto cnv_expr = make_rt_conv_expr(p, sp, cnv); - auto args = vec(cnv_expr, arg); + auto args = [cnv_expr, arg]; ret make_call(p, arg.span, path, args); } diff --git a/src/comp/front/lexer.rs b/src/comp/front/lexer.rs index 16f75b4ab058..c151dc2f7be1 100644 --- a/src/comp/front/lexer.rs +++ b/src/comp/front/lexer.rs @@ -91,7 +91,7 @@ fn new_reader(session sess, io::reader rdr, } } auto file = _str::unsafe_from_bytes(rdr.read_whole_stream()); - let vec[str] strs = vec(); + let vec[str] strs = []; auto rd = reader(sess, file, _str::byte_len(file), 0u, -1 as char, filemap.start_pos, filemap.start_pos, strs, filemap, itr); @@ -228,11 +228,11 @@ fn scan_exponent(reader rdr) -> option::t[str] { auto res = ""; if (c == 'e' || c == 'E') { - res += _str::from_bytes(vec(c as u8)); + res += _str::from_bytes([c as u8]); rdr.bump(); c = rdr.curr(); if (c == '-' || c == '+') { - res += _str::from_bytes(vec(c as u8)); + res += _str::from_bytes([c as u8]); rdr.bump(); } auto exponent = scan_dec_digits(rdr); @@ -256,7 +256,7 @@ fn scan_dec_digits(reader rdr) -> str { while (is_dec_digit (c) || c == '_') { if (c != '_') { - res += _str::from_bytes(vec(c as u8)); + res += _str::from_bytes([c as u8]); } rdr.bump(); c = rdr.curr(); @@ -766,7 +766,7 @@ fn read_block_comment(reader rdr) -> cmnt { auto p = rdr.get_chpos(); rdr.bump(); rdr.bump(); while (rdr.curr() == ' ') {rdr.bump();} - let vec[str] lines = vec(); + let vec[str] lines = []; auto val = ""; auto level = 1; while (true) { @@ -802,7 +802,7 @@ fn gather_comments(session sess, str path) -> vec[cmnt] { auto srdr = io::file_reader(path); auto itr = @interner::mk_interner[str](_str::hash, _str::eq); auto rdr = new_reader(sess, srdr, codemap::new_filemap(path, 0u), itr); - let vec[cmnt] comments = vec(); + let vec[cmnt] comments = []; while (!rdr.is_eof()) { while (true) { consume_whitespace(rdr); diff --git a/src/comp/front/parser.rs b/src/comp/front/parser.rs index 8649dc6fc426..3fa25857d3f4 100644 --- a/src/comp/front/parser.rs +++ b/src/comp/front/parser.rs @@ -422,7 +422,7 @@ fn parse_ty_constr(parser p) -> @ast::constr { fn parse_constrs(parser p) -> common::spanned[vec[@ast::constr]] { auto lo = p.get_lo_pos(); auto hi = p.get_hi_pos(); - let vec[@ast::constr] constrs = vec(); + let vec[@ast::constr] constrs = []; if (p.peek() == token::COLON) { p.bump(); while (true) { @@ -580,7 +580,7 @@ fn parse_seq_to_end[T](token::token ket, uint hi, parser p) -> vec[T] { let bool first = true; - let vec[T] v = vec(); + let vec[T] v = []; while (p.peek() != ket) { alt(sep) { case (some[token::token](?t)) { @@ -595,7 +595,7 @@ fn parse_seq_to_end[T](token::token ket, } // FIXME: v += f(p) doesn't work at the moment. let T t = f(p); - v += vec(t); + v += [t]; } hi = p.get_hi_pos(); expect(p, ket); @@ -677,7 +677,7 @@ fn parse_ty_args(parser p, uint hi) -> some(token::COMMA), pf, p); } - let vec[@ast::ty] v = vec(); + let vec[@ast::ty] v = []; auto pos = p.get_lo_pos(); ret spanned(hi, hi, v); } @@ -687,12 +687,12 @@ fn parse_path(parser p) -> ast::path { auto lo = p.get_lo_pos(); auto hi = lo; - let vec[ast::ident] ids = vec(); + let vec[ast::ident] ids = []; while (true) { alt (p.peek()) { case (token::IDENT(?i, _)) { hi = p.get_hi_pos(); - ids += vec(p.get_str(i)); + ids += [p.get_str(i)]; p.bump(); if (p.peek() == token::MOD_SEP) { p.bump(); @@ -797,7 +797,7 @@ fn parse_bottom_expr(parser p) -> @ast::expr { pf, hi, p)); } - let vec[@ast::method] meths = vec(); + let vec[@ast::method] meths = []; let option::t[ast::ident] with_obj = none[ast::ident]; expect(p, token::LBRACE); @@ -830,7 +830,7 @@ fn parse_bottom_expr(parser p) -> @ast::expr { } else if (eat_word(p, "rec")) { expect(p, token::LPAREN); - auto fields = vec(parse_field(p)); + auto fields = [parse_field(p)]; auto more = true; auto base = none[@ast::expr]; @@ -846,7 +846,7 @@ fn parse_bottom_expr(parser p) -> @ast::expr { more = false; } else if (p.peek() == token::COMMA) { p.bump(); - fields += vec(parse_field(p)); + fields += [parse_field(p)]; } else { unexpected(p, p.peek()); } @@ -1151,7 +1151,7 @@ type op_spec = rec(token::token tok, ast::binop op, int prec); // FIXME make this a const, don't store it in parser state fn prec_table() -> vec[op_spec] { - ret vec(rec(tok=token::BINOP(token::STAR), op=ast::mul, prec=11), + ret [rec(tok=token::BINOP(token::STAR), op=ast::mul, prec=11), rec(tok=token::BINOP(token::SLASH), op=ast::div, prec=11), rec(tok=token::BINOP(token::PERCENT), op=ast::rem, prec=11), rec(tok=token::BINOP(token::PLUS), op=ast::add, prec=10), @@ -1170,7 +1170,7 @@ fn prec_table() -> vec[op_spec] { rec(tok=token::EQEQ, op=ast::eq, prec=3), rec(tok=token::NE, op=ast::ne, prec=3), rec(tok=token::ANDAND, op=ast::and, prec=2), - rec(tok=token::OROR, op=ast::or, prec=1)); + rec(tok=token::OROR, op=ast::or, prec=1)]; } fn parse_binops(parser p) -> @ast::expr { @@ -1342,14 +1342,14 @@ fn parse_alt_expr(parser p) -> @ast::expr { expect(p, token::RPAREN); expect(p, token::LBRACE); - let vec[ast::arm] arms = vec(); + let vec[ast::arm] arms = []; while (p.peek() != token::RBRACE) { if (eat_word(p, "case")) { expect(p, token::LPAREN); auto pat = parse_pat(p); expect(p, token::RPAREN); auto block = parse_block(p); - arms += vec(rec(pat=pat, block=block)); + arms += [rec(pat=pat, block=block)]; } else if (p.peek() == token::RBRACE) { /* empty */ } else { @@ -1480,7 +1480,7 @@ fn parse_pat(parser p) -> @ast::pat { args = a.node; hi = a.span.hi; } - case (_) { args = vec(); } + case (_) { args = []; } } pat = ast::pat_tag(tag_path, args, p.get_ann()); @@ -1630,7 +1630,7 @@ fn stmt_ends_with_semi(@ast::stmt stmt) -> bool { fn parse_block(parser p) -> ast::block { auto lo = p.get_lo_pos(); - let vec[@ast::stmt] stmts = vec(); + let vec[@ast::stmt] stmts = []; let option::t[@ast::expr] expr = none[@ast::expr]; expect(p, token::LBRACE); @@ -1650,7 +1650,7 @@ fn parse_block(parser p) -> ast::block { alt (p.peek()) { case (token::SEMI) { p.bump(); - stmts += vec(stmt); + stmts += [stmt]; } case (token::RBRACE) { expr = some(e); } case (?t) { @@ -1660,13 +1660,13 @@ fn parse_block(parser p) -> ast::block { token::to_str(p.get_reader(), t)); fail; } - stmts += vec(stmt); + stmts += [stmt]; } } } case (none[@ast::expr]) { // Not an expression statement. - stmts += vec(stmt); + stmts += [stmt]; // FIXME: crazy differentiation between conditions // used in branches and binary expressions in rustboot // means we cannot use && here. I know, right? @@ -1693,7 +1693,7 @@ fn parse_ty_param(parser p) -> ast::ty_param { } fn parse_ty_params(parser p) -> vec[ast::ty_param] { - let vec[ast::ty_param] ty_params = vec(); + let vec[ast::ty_param] ty_params = []; if (p.peek() == token::LBRACKET) { auto f = parse_ty_param; // FIXME: pass as lval directly ty_params = parse_seq[ast::ty_param](token::LBRACKET, token::RBRACKET, @@ -1775,7 +1775,7 @@ fn parse_method(parser p) -> @ast::method { fn parse_dtor(parser p) -> @ast::method { auto lo = p.get_last_lo_pos(); let ast::block b = parse_block(p); - let vec[ast::arg] inputs = vec(); + let vec[ast::arg] inputs = []; let @ast::ty output = @spanned(lo, lo, ast::ty_nil); let ast::fn_decl d = rec(inputs=inputs, output=output, @@ -1802,7 +1802,7 @@ fn parse_item_obj(parser p, ast::layer lyr) -> @ast::item { some(token::COMMA), pf, p); - let vec[@ast::method] meths = vec(); + let vec[@ast::method] meths = []; let option::t[@ast::method] dtor = none[@ast::method]; expect(p, token::LBRACE); @@ -1829,9 +1829,9 @@ fn parse_item_obj(parser p, ast::layer lyr) -> @ast::item { fn parse_mod_items(parser p, token::token term) -> ast::_mod { auto view_items = parse_view(p); - let vec[@ast::item] items = vec(); + let vec[@ast::item] items = []; while (p.peek() != term) { - items += vec(parse_item(p)); + items += [parse_item(p)]; } ret rec(view_items=view_items, items=items); } @@ -1899,12 +1899,12 @@ fn parse_native_item(parser p) -> @ast::native_item { fn parse_native_mod_items(parser p, str native_name, ast::native_abi abi) -> ast::native_mod { - let vec[@ast::native_item] items = vec(); + let vec[@ast::native_item] items = []; auto view_items = parse_native_view(p); while (p.peek() != token::RBRACE) { - items += vec(parse_native_item(p)); + items += [parse_native_item(p)]; } ret rec(native_name=native_name, abi=abi, view_items=view_items, @@ -1982,7 +1982,7 @@ fn parse_item_tag(parser p) -> @ast::item { auto id = parse_ident(p); auto ty_params = parse_ty_params(p); - let vec[ast::variant] variants = vec(); + let vec[ast::variant] variants = []; expect(p, token::LBRACE); while (p.peek() != token::RBRACE) { auto tok = p.peek(); @@ -1992,7 +1992,7 @@ fn parse_item_tag(parser p) -> @ast::item { auto vlo = p.get_lo_pos(); p.bump(); - let vec[ast::variant_arg] args = vec(); + let vec[ast::variant_arg] args = []; alt (p.peek()) { case (token::LPAREN) { auto f = parse_ty; @@ -2001,7 +2001,7 @@ fn parse_item_tag(parser p) -> @ast::item { some(token::COMMA), f, p); for (@ast::ty ty in arg_tys.node) { - args += vec(rec(ty=ty, id=p.next_def_id())); + args += [rec(ty=ty, id=p.next_def_id())]; } } case (_) { /* empty */ } @@ -2013,7 +2013,7 @@ fn parse_item_tag(parser p) -> @ast::item { auto id = p.next_def_id(); auto vr = rec(name=p.get_str(name), args=args, id=id, ann=p.get_ann()); - variants += vec(spanned[ast::variant_](vlo, vhi, vr)); + variants += [spanned[ast::variant_](vlo, vhi, vr)]; } case (token::RBRACE) { /* empty */ } case (_) { @@ -2135,7 +2135,7 @@ fn parse_optional_meta(parser p) -> vec[@ast::meta_item] { ret parse_meta(p); } case (_) { - let vec[@ast::meta_item] v = vec(); + let vec[@ast::meta_item] v = []; ret v; } } @@ -2156,11 +2156,11 @@ fn parse_rest_import_name(parser p, ast::ident first, option::t[ast::ident] def_ident) -> @ast::view_item { auto lo = p.get_lo_pos(); - let vec[ast::ident] identifiers = vec(first); + let vec[ast::ident] identifiers = [first]; while (p.peek() != token::SEMI) { expect(p, token::MOD_SEP); auto i = parse_ident(p); - identifiers += vec(i); + identifiers += [i]; } auto hi = p.get_hi_pos(); p.bump(); @@ -2248,17 +2248,17 @@ fn is_view_item(&parser p) -> bool { } fn parse_view(parser p) -> vec[@ast::view_item] { - let vec[@ast::view_item] items = vec(); + let vec[@ast::view_item] items = []; while (is_view_item(p)) { - items += vec(parse_view_item(p)); + items += [parse_view_item(p)]; } ret items; } fn parse_native_view(parser p) -> vec[@ast::view_item] { - let vec[@ast::view_item] items = vec(); + let vec[@ast::view_item] items = []; while (is_view_item(p)) { - items += vec(parse_view_item(p)); + items += [parse_view_item(p)]; } ret items; } @@ -2267,7 +2267,7 @@ fn parse_native_view(parser p) -> vec[@ast::view_item] { fn parse_crate_from_source_file(parser p) -> @ast::crate { auto lo = p.get_lo_pos(); auto m = parse_mod_items(p, token::EOF); - let vec[@ast::crate_directive] cdirs = vec(); + let vec[@ast::crate_directive] cdirs = []; ret @spanned(lo, p.get_lo_pos(), rec(directives=cdirs, module=m)); } @@ -2362,7 +2362,7 @@ fn parse_crate_directive(parser p) -> ast::crate_directive fn parse_crate_directives(parser p, token::token term) -> vec[@ast::crate_directive] { - let vec[@ast::crate_directive] cdirs = vec(); + let vec[@ast::crate_directive] cdirs = []; while (p.peek() != term) { auto cdir = @parse_crate_directive(p); @@ -2376,7 +2376,7 @@ fn parse_crate_from_crate_file(parser p) -> @ast::crate { auto lo = p.get_lo_pos(); auto prefix = std::fs::dirname(p.get_filemap().name); auto cdirs = parse_crate_directives(p, token::EOF); - let vec[str] deps = vec(); + let vec[str] deps = []; auto cx = @rec(p=p, mode=eval::mode_parse, mutable deps = deps, diff --git a/src/comp/lib/llvm.rs b/src/comp/lib/llvm.rs index ba607d3e046d..4a8e42a42d00 100644 --- a/src/comp/lib/llvm.rs +++ b/src/comp/lib/llvm.rs @@ -1395,7 +1395,7 @@ obj builder(BuilderRef B, @mutable bool terminated) { let ValueRef T = llvm::LLVMGetNamedFunction(M, _str::buf("llvm.trap")); assert (T as int != 0); - let vec[ValueRef] Args = vec(); + let vec[ValueRef] Args = []; ret llvm::LLVMBuildCall(B, T, _vec::buf[ValueRef](Args), _vec::len[ValueRef](Args), @@ -1467,7 +1467,7 @@ fn mk_type_names() -> type_names { } fn type_to_str(type_names names, TypeRef ty) -> str { - let vec[TypeRef] v = vec(); + let vec[TypeRef] v = []; ret type_to_str_inner(names, v, ty); } @@ -1478,7 +1478,7 @@ fn type_to_str_inner(type_names names, ret names.get_name(ty); } - auto outer = outer0 + vec(ty); + auto outer = outer0 + [ty]; let int kind = llvm::LLVMGetTypeKind(ty); diff --git a/src/comp/middle/fold.rs b/src/comp/middle/fold.rs index 7a9a67ddfcae..606b37e49fc3 100644 --- a/src/comp/middle/fold.rs +++ b/src/comp/middle/fold.rs @@ -358,7 +358,7 @@ type ast_fold[ENV] = //// Fold drivers. fn fold_path[ENV](&ENV env, &ast_fold[ENV] fld, &path p) -> path { - let vec[@ast::ty] tys_ = vec(); + let vec[@ast::ty] tys_ = []; for (@ast::ty t in p.node.types) { _vec::push[@ast::ty](tys_, fold_ty(env, fld, t)); } @@ -398,7 +398,7 @@ fn fold_ty[ENV](&ENV env, &ast_fold[ENV] fld, &@ty t) -> @ty { } case (ast::ty_tup(?elts)) { - let vec[mt] elts_ = vec(); + let vec[mt] elts_ = []; for (mt elt in elts) { auto ty_ = fold_ty(env, fld, elt.ty); _vec::push[mt](elts_, rec(ty=ty_, mut=elt.mut)); @@ -407,7 +407,7 @@ fn fold_ty[ENV](&ENV env, &ast_fold[ENV] fld, &@ty t) -> @ty { } case (ast::ty_rec(?flds)) { - let vec[ast::ty_field] flds_ = vec(); + let vec[ast::ty_field] flds_ = []; for (ast::ty_field f in flds) { auto ty_ = fold_ty(env, fld, f.mt.ty); _vec::push[ast::ty_field] @@ -417,7 +417,7 @@ fn fold_ty[ENV](&ENV env, &ast_fold[ENV] fld, &@ty t) -> @ty { } case (ast::ty_obj(?meths)) { - let vec[ast::ty_method] meths_ = vec(); + let vec[ast::ty_method] meths_ = []; for (ast::ty_method m in meths) { auto tfn = fold_ty_fn(env_, fld, t.span, m.proto, m.inputs, m.output); @@ -458,11 +458,11 @@ fn fold_ty_fn[ENV](&ENV env, &ast_fold[ENV] fld, &span sp, &vec[rec(ast::mode mode, @ty ty)] inputs, &@ty output) -> @ty { auto output_ = fold_ty(env, fld, output); - let vec[rec(ast::mode mode, @ty ty)] inputs_ = vec(); + let vec[rec(ast::mode mode, @ty ty)] inputs_ = []; for (rec(ast::mode mode, @ty ty) input in inputs) { auto ty_ = fold_ty(env, fld, input.ty); auto input_ = rec(ty=ty_ with input); - inputs_ += vec(input_); + inputs_ += [input_]; } ret fld.fold_ty_fn(env, sp, proto, inputs_, output_); } @@ -524,9 +524,9 @@ fn fold_pat[ENV](&ENV env, &ast_fold[ENV] fld, &@ast::pat p) -> @ast::pat { case (ast::pat_tag(?path, ?pats, ?t)) { auto ppath = fold_path(env, fld, path); - let vec[@ast::pat] ppats = vec(); + let vec[@ast::pat] ppats = []; for (@ast::pat pat in pats) { - ppats += vec(fold_pat(env_, fld, pat)); + ppats += [fold_pat(env_, fld, pat)]; } ret fld.fold_pat_tag(env_, p.span, ppath, ppats, t); @@ -536,7 +536,7 @@ fn fold_pat[ENV](&ENV env, &ast_fold[ENV] fld, &@ast::pat p) -> @ast::pat { fn fold_exprs[ENV](&ENV env, &ast_fold[ENV] fld, &vec[@expr] es) -> vec[@expr] { - let vec[@expr] exprs = vec(); + let vec[@expr] exprs = []; for (@expr e in es) { _vec::push[@expr](exprs, fold_expr(env, fld, e)); } @@ -568,19 +568,19 @@ fn fold_expr[ENV](&ENV env, &ast_fold[ENV] fld, &@expr e) -> @expr { } case (ast::expr_tup(?es, ?t)) { - let vec[ast::elt] elts = vec(); + let vec[ast::elt] elts = []; for (ast::elt e in es) { - elts += vec(fold_tup_elt[ENV](env, fld, e)); + elts += [fold_tup_elt[ENV](env, fld, e)]; } auto t2 = fld.fold_ann(env_, t); ret fld.fold_expr_tup(env_, e.span, elts, t2); } case (ast::expr_rec(?fs, ?base, ?t)) { - let vec[ast::field] fields = vec(); + let vec[ast::field] fields = []; let option::t[@expr] b = none[@expr]; for (ast::field f in fs) { - fields += vec(fold_rec_field(env, fld, f)); + fields += [fold_rec_field(env, fld, f)]; } alt (base) { case (none[@ast::expr]) { } @@ -606,14 +606,14 @@ fn fold_expr[ENV](&ENV env, &ast_fold[ENV] fld, &@expr e) -> @expr { case (ast::expr_bind(?f, ?args_opt, ?t)) { auto ff = fold_expr(env_, fld, f); - let vec[option::t[@ast::expr]] aargs_opt = vec(); + let vec[option::t[@ast::expr]] aargs_opt = []; for (option::t[@ast::expr] t_opt in args_opt) { alt (t_opt) { case (none[@ast::expr]) { - aargs_opt += vec(none[@ast::expr]); + aargs_opt += [none[@ast::expr]]; } case (some[@ast::expr](?e)) { - aargs_opt += vec(some(fold_expr(env_, fld, e))); + aargs_opt += [some(fold_expr(env_, fld, e))]; } case (none[@ast::expr]) { /* empty */ } } @@ -700,9 +700,9 @@ fn fold_expr[ENV](&ENV env, &ast_fold[ENV] fld, &@expr e) -> @expr { case (ast::expr_alt(?expr, ?arms, ?t)) { auto eexpr = fold_expr(env_, fld, expr); - let vec[ast::arm] aarms = vec(); + let vec[ast::arm] aarms = []; for (ast::arm a in arms) { - aarms += vec(fold_arm(env_, fld, a)); + aarms += [fold_arm(env_, fld, a)]; } auto t2 = fld.fold_ann(env_, t); ret fld.fold_expr_alt(env_, e.span, eexpr, aarms, t2); @@ -887,7 +887,7 @@ fn fold_block[ENV](&ENV env, &ast_fold[ENV] fld, &block blk) -> block { ret blk; } - let vec[@ast::stmt] stmts = vec(); + let vec[@ast::stmt] stmts = []; for (@ast::stmt s in blk.node.stmts) { auto new_stmt = fold_stmt[ENV](env_, fld, s); _vec::push[@ast::stmt](stmts, new_stmt); @@ -921,9 +921,9 @@ fn fold_arg[ENV](&ENV env, &ast_fold[ENV] fld, &arg a) -> arg { fn fold_fn_decl[ENV](&ENV env, &ast_fold[ENV] fld, &ast::fn_decl decl) -> ast::fn_decl { - let vec[ast::arg] inputs = vec(); + let vec[ast::arg] inputs = []; for (ast::arg a in decl.inputs) { - inputs += vec(fold_arg(env, fld, a)); + inputs += [fold_arg(env, fld, a)]; } auto output = fold_ty[ENV](env, fld, decl.output); ret fld.fold_fn_decl(env, inputs, output, decl.purity); @@ -953,10 +953,10 @@ fn fold_method[ENV](&ENV env, &ast_fold[ENV] fld, fn fold_obj[ENV](&ENV env, &ast_fold[ENV] fld, &ast::_obj ob) -> ast::_obj { - let vec[ast::obj_field] fields = vec(); - let vec[@ast::method] meths = vec(); + let vec[ast::obj_field] fields = []; + let vec[@ast::method] meths = []; for (ast::obj_field f in ob.fields) { - fields += vec(fold_obj_field(env, fld, f)); + fields += [fold_obj_field(env, fld, f)]; } let option::t[@ast::method] dtor = none[@ast::method]; alt (ob.dtor) { @@ -965,7 +965,7 @@ fn fold_obj[ENV](&ENV env, &ast_fold[ENV] fld, &ast::_obj ob) -> ast::_obj { dtor = some[@ast::method](fold_method[ENV](env, fld, m)); } } - let vec[ast::ty_param] tp = vec(); + let vec[ast::ty_param] tp = []; for (@ast::method m in ob.methods) { // Fake-up an ast::item for this method. // FIXME: this is kinda awful. Maybe we should reformulate @@ -990,9 +990,9 @@ fn fold_anon_obj[ENV](&ENV env, &ast_fold[ENV] fld, &ast::anon_obj ob) alt (ob.fields) { case (none[vec[ast::obj_field]]) { } case (some[vec[ast::obj_field]](?v)) { - let vec[ast::obj_field] fields = vec(); + let vec[ast::obj_field] fields = []; for (ast::obj_field f in v) { - fields += vec(fold_obj_field(env, fld, f)); + fields += [fold_obj_field(env, fld, f)]; } } } @@ -1007,8 +1007,8 @@ fn fold_anon_obj[ENV](&ENV env, &ast_fold[ENV] fld, &ast::anon_obj ob) } // Methods - let vec[@ast::method] meths = vec(); - let vec[ast::ty_param] tp = vec(); + let vec[@ast::method] meths = []; + let vec[ast::ty_param] tp = []; for (@ast::method m in ob.methods) { // Fake-up an ast::item for this method. // FIXME: this is kinda awful. Maybe we should reformulate @@ -1089,16 +1089,16 @@ fn fold_item[ENV](&ENV env, &ast_fold[ENV] fld, &@item i) -> @item { } case (ast::item_tag(?ident, ?variants, ?ty_params, ?id, ?ann)) { - let vec[ast::variant] new_variants = vec(); + let vec[ast::variant] new_variants = []; for (ast::variant v in variants) { - let vec[ast::variant_arg] new_args = vec(); + let vec[ast::variant_arg] new_args = []; for (ast::variant_arg va in v.node.args) { auto new_ty = fold_ty[ENV](env_, fld, va.ty); - new_args += vec(rec(ty=new_ty, id=va.id)); + new_args += [rec(ty=new_ty, id=va.id)]; } auto new_v = rec(name=v.node.name, args=new_args, id=v.node.id, ann=v.node.ann); - new_variants += vec(respan[ast::variant_](v.span, new_v)); + new_variants += [respan[ast::variant_](v.span, new_v)]; } ret fld.fold_item_tag(env_, i.span, ident, new_variants, ty_params, id, ann); @@ -1116,8 +1116,8 @@ fn fold_item[ENV](&ENV env, &ast_fold[ENV] fld, &@item i) -> @item { fn fold_mod[ENV](&ENV e, &ast_fold[ENV] fld, &ast::_mod m) -> ast::_mod { - let vec[@view_item] view_items = vec(); - let vec[@item] items = vec(); + let vec[@view_item] view_items = []; + let vec[@item] items = []; for (@view_item vi in m.view_items) { auto new_vi = fold_view_item[ENV](e, fld, vi); @@ -1154,8 +1154,8 @@ fn fold_native_item[ENV](&ENV env, &ast_fold[ENV] fld, fn fold_native_mod[ENV](&ENV e, &ast_fold[ENV] fld, &ast::native_mod m) -> ast::native_mod { - let vec[@view_item] view_items = vec(); - let vec[@native_item] items = vec(); + let vec[@view_item] view_items = []; + let vec[@native_item] items = []; for (@view_item vi in m.view_items) { auto new_vi = fold_view_item[ENV](e, fld, vi); diff --git a/src/comp/middle/metadata.rs b/src/comp/middle/metadata.rs index b307842412da..daf52f7fbded 100644 --- a/src/comp/middle/metadata.rs +++ b/src/comp/middle/metadata.rs @@ -299,8 +299,8 @@ fn add_to_index(&ebml::writer ebml_w, &vec[str] path, &mutable vec[tup(str, uint)] index, &str name) { - auto full_path = path + vec(name); - index += vec(tup(_str::connect(full_path, "::"), ebml_w.writer.tell())); + auto full_path = path + [name]; + index += [tup(_str::connect(full_path, "::"), ebml_w.writer.tell())]; } fn encode_native_module_item_paths(&ebml::writer ebml_w, @@ -353,7 +353,7 @@ fn encode_module_item_paths(&ebml::writer ebml_w, ebml::start_tag(ebml_w, tag_paths_data_mod); encode_name(ebml_w, id); encode_def_id(ebml_w, did); - encode_module_item_paths(ebml_w, _mod, path + vec(id), index); + encode_module_item_paths(ebml_w, _mod, path + [id], index); ebml::end_tag(ebml_w); } case (ast::item_native_mod(?id, ?nmod, ?did)) { @@ -361,7 +361,7 @@ fn encode_module_item_paths(&ebml::writer ebml_w, ebml::start_tag(ebml_w, tag_paths_data_mod); encode_name(ebml_w, id); encode_def_id(ebml_w, did); - encode_native_module_item_paths(ebml_w, nmod, path + vec(id), + encode_native_module_item_paths(ebml_w, nmod, path + [id], index); ebml::end_tag(ebml_w); } @@ -400,8 +400,8 @@ fn encode_module_item_paths(&ebml::writer ebml_w, fn encode_item_paths(&ebml::writer ebml_w, &@ast::crate crate) -> vec[tup(str, uint)] { - let vec[tup(str, uint)] index = vec(); - let vec[str] path = vec(); + let vec[tup(str, uint)] index = []; + let vec[str] path = []; ebml::start_tag(ebml_w, tag_paths); encode_module_item_paths(ebml_w, crate.node.module, path, index); ebml::end_tag(ebml_w); @@ -413,7 +413,7 @@ fn encode_item_paths(&ebml::writer ebml_w, &@ast::crate crate) fn encode_kind(&ebml::writer ebml_w, u8 c) { ebml::start_tag(ebml_w, tag_items_data_item_kind); - ebml_w.writer.write(vec(c)); + ebml_w.writer.write([c]); ebml::end_tag(ebml_w); } @@ -470,7 +470,7 @@ fn encode_tag_variant_info(&@trans::crate_ctxt cx, &ebml::writer ebml_w, &mutable vec[tup(int, uint)] index, &vec[ast::ty_param] ty_params) { for (ast::variant variant in variants) { - index += vec(tup(variant.node.id._1, ebml_w.writer.tell())); + index += [tup(variant.node.id._1, ebml_w.writer.tell())]; ebml::start_tag(ebml_w, tag_items_data_item); encode_def_id(ebml_w, variant.node.id); @@ -549,7 +549,7 @@ fn encode_info_for_item(@trans::crate_ctxt cx, &ebml::writer ebml_w, encode_symbol(cx, ebml_w, odid.ctor); ebml::end_tag(ebml_w); - index += vec(tup(odid.ty._1, ebml_w.writer.tell())); + index += [tup(odid.ty._1, ebml_w.writer.tell())]; ebml::start_tag(ebml_w, tag_items_data_item); encode_def_id(ebml_w, odid.ty); encode_kind(ebml_w, 'y' as u8); @@ -582,16 +582,16 @@ fn encode_info_for_native_item(&@trans::crate_ctxt cx, &ebml::writer ebml_w, fn encode_info_for_items(&@trans::crate_ctxt cx, &ebml::writer ebml_w) -> vec[tup(int, uint)] { - let vec[tup(int, uint)] index = vec(); + let vec[tup(int, uint)] index = []; ebml::start_tag(ebml_w, tag_items_data); for each (@tup(ast::def_id, @ast::item) kvp in cx.items.items()) { - index += vec(tup(kvp._0._1, ebml_w.writer.tell())); + index += [tup(kvp._0._1, ebml_w.writer.tell())]; encode_info_for_item(cx, ebml_w, kvp._1, index); } for each (@tup(ast::def_id, @ast::native_item) kvp in cx.native_items.items()) { - index += vec(tup(kvp._0._1, ebml_w.writer.tell())); + index += [tup(kvp._0._1, ebml_w.writer.tell())]; encode_info_for_native_item(cx, ebml_w, kvp._1); } ebml::end_tag(ebml_w); @@ -618,15 +618,15 @@ fn hash_path(&str s) -> uint { fn create_index[T](&vec[tup(T, uint)] index, fn(&T) -> uint hash_fn) -> vec[vec[tup(T, uint)]] { - let vec[vec[tup(T, uint)]] buckets = vec(); + let vec[vec[tup(T, uint)]] buckets = []; for each (uint i in _uint::range(0u, 256u)) { - let vec[tup(T, uint)] bucket = vec(); - buckets += vec(bucket); + let vec[tup(T, uint)] bucket = []; + buckets += [bucket]; } for (tup(T, uint) elt in index) { auto h = hash_fn(elt._0); - buckets.(h % 256u) += vec(elt); + buckets.(h % 256u) += [elt]; } ret buckets; @@ -638,10 +638,10 @@ fn encode_index[T](&ebml::writer ebml_w, &vec[vec[tup(T, uint)]] buckets, ebml::start_tag(ebml_w, tag_index); - let vec[uint] bucket_locs = vec(); + let vec[uint] bucket_locs = []; ebml::start_tag(ebml_w, tag_index_buckets); for (vec[tup(T, uint)] bucket in buckets) { - bucket_locs += vec(ebml_w.writer.tell()); + bucket_locs += [ebml_w.writer.tell()]; ebml::start_tag(ebml_w, tag_index_buckets_bucket); for (tup(T, uint) elt in bucket) { @@ -698,7 +698,7 @@ fn encode_metadata(&@trans::crate_ctxt cx, &@ast::crate crate) // Pad this, since something (LLVM, presumably) is cutting off the // remaining % 4 bytes. - buf_w.write(vec(0u8, 0u8, 0u8, 0u8)); + buf_w.write([0u8, 0u8, 0u8, 0u8]); ret C_postr(string_w.get_str()); } @@ -709,7 +709,7 @@ fn write_metadata(&@trans::crate_ctxt cx, &@ast::crate crate) { llmeta = encode_metadata(cx, crate); } - auto llconst = trans::C_struct(vec(llmeta)); + auto llconst = trans::C_struct([llmeta]); auto llglobal = llvm::LLVMAddGlobal(cx.llmod, trans::val_ty(llconst), _str::buf("rust_metadata")); llvm::LLVMSetInitializer(llglobal, llconst); diff --git a/src/comp/middle/resolve.rs b/src/comp/middle/resolve.rs index f530d3f412f2..07667e114fa7 100644 --- a/src/comp/middle/resolve.rs +++ b/src/comp/middle/resolve.rs @@ -253,7 +253,7 @@ fn pop_env_for_item(@mutable list[scope] sc, &@ast::item i) { } fn push_env_for_method(@mutable list[scope] sc, &@ast::method m) { - let vec[ast::ty_param] tp = vec(); + let vec[ast::ty_param] tp = []; let @ast::item i = @rec(node=ast::item_fn(m.node.ident, m.node.meth, tp, @@ -686,7 +686,7 @@ fn lookup_in_mod(&env e, def m, &ident id, namespace ns, dir dr) if (defid._0 != ast::local_crate) { // Not in this crate auto cached = e.ext_cache.find(tup(defid,id,ns)); if (!option::is_none(cached)) { ret cached; } - auto path = vec(id); + auto path = [id]; if (defid._1 != -1) { path = e.ext_map.get(defid) + path; } diff --git a/src/comp/middle/trans.rs b/src/comp/middle/trans.rs index 3fa7c8012c20..4c9f170ecd44 100644 --- a/src/comp/middle/trans.rs +++ b/src/comp/middle/trans.rs @@ -193,7 +193,7 @@ fn sep() -> str { } fn extend_path(@local_ctxt cx, &str name) -> @local_ctxt { - ret @rec(path = cx.path + vec(name) with *cx); + ret @rec(path = cx.path + [name] with *cx); } fn path_name(&vec[str] path) -> str { @@ -341,8 +341,8 @@ fn T_fn(vec[TypeRef] inputs, TypeRef output) -> TypeRef { } fn T_fn_pair(&type_names tn, TypeRef tfn) -> TypeRef { - ret T_struct(vec(T_ptr(tfn), - T_opaque_closure_ptr(tn))); + ret T_struct([T_ptr(tfn), + T_opaque_closure_ptr(tn)]); } fn T_ptr(TypeRef t) -> TypeRef { @@ -365,7 +365,7 @@ fn T_task(&type_names tn) -> TypeRef { ret tn.get_type(s); } - auto t = T_struct(vec(T_int(), // Refcount + auto t = T_struct([T_int(), // Refcount T_int(), // Delegate pointer T_int(), // Stack segment pointer T_int(), // Runtime SP @@ -373,7 +373,7 @@ fn T_task(&type_names tn) -> TypeRef { T_int(), // GC chain T_int(), // Domain pointer T_int() // Crate cache pointer - )); + ]); tn.associate(s, t); ret t; } @@ -426,19 +426,19 @@ fn T_tydesc(&type_names tn) -> TypeRef { auto abs_tydesc = llvm::LLVMResolveTypeHandle(th.llth); auto tydescpp = T_ptr(T_ptr(abs_tydesc)); auto pvoid = T_ptr(T_i8()); - auto glue_fn_ty = T_ptr(T_fn(vec(T_ptr(T_nil()), + auto glue_fn_ty = T_ptr(T_fn([T_ptr(T_nil()), T_taskptr(tn), T_ptr(T_nil()), tydescpp, - pvoid), T_void())); - auto cmp_glue_fn_ty = T_ptr(T_fn(vec(T_ptr(T_i1()), + pvoid], T_void())); + auto cmp_glue_fn_ty = T_ptr(T_fn([T_ptr(T_i1()), T_taskptr(tn), T_ptr(T_nil()), tydescpp, pvoid, pvoid, - T_i8()), T_void())); - auto tydesc = T_struct(vec(tydescpp, // first_param + T_i8()], T_void())); + auto tydesc = T_struct([tydescpp, // first_param T_int(), // size T_int(), // align glue_fn_ty, // take_glue @@ -448,7 +448,7 @@ fn T_tydesc(&type_names tn) -> TypeRef { glue_fn_ty, // mark_glue glue_fn_ty, // obj_drop_glue glue_fn_ty, // is_stateful - cmp_glue_fn_ty)); // cmp_glue + cmp_glue_fn_ty]); // cmp_glue llvm::LLVMRefineType(abs_tydesc, tydesc); auto t = llvm::LLVMResolveTypeHandle(th.llth); @@ -462,12 +462,12 @@ fn T_array(TypeRef t, uint n) -> TypeRef { } fn T_vec(TypeRef t) -> TypeRef { - ret T_struct(vec(T_int(), // Refcount + ret T_struct([T_int(), // Refcount T_int(), // Alloc T_int(), // Fill T_int(), // Pad T_array(t, 1u) // Body elements - )); + ]); } fn T_opaque_vec_ptr() -> TypeRef { @@ -479,15 +479,15 @@ fn T_str() -> TypeRef { } fn T_box(TypeRef t) -> TypeRef { - ret T_struct(vec(T_int(), t)); + ret T_struct([T_int(), t]); } fn T_port(TypeRef t) -> TypeRef { - ret T_struct(vec(T_int())); // Refcount + ret T_struct([T_int()]); // Refcount } fn T_chan(TypeRef t) -> TypeRef { - ret T_struct(vec(T_int())); // Refcount + ret T_struct([T_int()]); // Refcount } fn T_crate(&type_names tn) -> TypeRef { @@ -496,7 +496,7 @@ fn T_crate(&type_names tn) -> TypeRef { ret tn.get_type(s); } - auto t = T_struct(vec(T_int(), // ptrdiff_t image_base_off + auto t = T_struct([T_int(), // ptrdiff_t image_base_off T_int(), // uintptr_t self_addr T_int(), // ptrdiff_t debug_abbrev_off T_int(), // size_t debug_abbrev_sz @@ -511,7 +511,7 @@ fn T_crate(&type_names tn) -> TypeRef { T_int(), // int n_c_syms T_int(), // int n_libs T_int() // uintptr_t abi_tag - )); + ]); tn.associate(s, t); ret t; } @@ -544,10 +544,10 @@ fn T_closure_ptr(&type_names tn, // NB: keep this in sync with code in trans_bind; we're making // an LLVM typeref structure that has the same "shape" as the ty::t // it constructs. - ret T_ptr(T_box(T_struct(vec(T_ptr(T_tydesc(tn)), + ret T_ptr(T_box(T_struct([T_ptr(T_tydesc(tn)), lltarget_ty, llbindings_ty, - T_captured_tydescs(tn, n_ty_params)) + T_captured_tydescs(tn, n_ty_params)] ))); } @@ -556,8 +556,8 @@ fn T_opaque_closure_ptr(&type_names tn) -> TypeRef { if (tn.name_has_type(s)) { ret tn.get_type(s); } - auto t = T_closure_ptr(tn, T_struct(vec(T_ptr(T_nil()), - T_ptr(T_nil()))), + auto t = T_closure_ptr(tn, T_struct([T_ptr(T_nil()), + T_ptr(T_nil())]), T_nil(), 0u); tn.associate(s, t); @@ -572,9 +572,9 @@ fn T_tag(&type_names tn, uint size) -> TypeRef { auto t; if (size == 0u) { - t = T_struct(vec(T_int())); + t = T_struct([T_int()]); } else { - t = T_struct(vec(T_int(), T_array(T_i8(), size))); + t = T_struct([T_int(), T_array(T_i8(), size)]); } tn.associate(s, t); @@ -586,7 +586,7 @@ fn T_opaque_tag(&type_names tn) -> TypeRef { if (tn.name_has_type(s)) { ret tn.get_type(s); } - auto t = T_struct(vec(T_int(), T_i8())); + auto t = T_struct([T_int(), T_i8()]); tn.associate(s, t); ret t; } @@ -603,8 +603,8 @@ fn T_obj_ptr(&type_names tn, uint n_captured_tydescs) -> TypeRef { // This function is not publicly exposed because it returns an incomplete // type. The dynamically-sized fields follow the captured tydescs. fn T_obj(type_names tn, uint n_captured_tydescs) -> TypeRef { - ret T_struct(vec(T_ptr(T_tydesc(tn)), - T_captured_tydescs(tn, n_captured_tydescs))); + ret T_struct([T_ptr(T_tydesc(tn)), + T_captured_tydescs(tn, n_captured_tydescs)]); } ret T_ptr(T_box(T_obj(tn, n_captured_tydescs))); @@ -635,11 +635,11 @@ fn type_of(&@crate_ctxt cx, &ty::t t) -> TypeRef { fn type_of_explicit_args(&@crate_ctxt cx, &vec[ty::arg] inputs) -> vec[TypeRef] { - let vec[TypeRef] atys = vec(); + let vec[TypeRef] atys = []; for (ty::arg arg in inputs) { if (ty::type_has_dynamic_size(cx.tcx, arg.ty)) { assert (arg.mode == ty::mo_alias); - atys += vec(T_typaram_ptr(cx.tn)); + atys += [T_typaram_ptr(cx.tn)]; } else { let TypeRef t; alt (arg.mode) { @@ -650,7 +650,7 @@ fn type_of_explicit_args(&@crate_ctxt cx, t = type_of_inner(cx, arg.ty); } } - atys += vec(t); + atys += [t]; } } ret atys; @@ -669,26 +669,26 @@ fn type_of_fn_full(&@crate_ctxt cx, &vec[ty::arg] inputs, &ty::t output, uint ty_param_count) -> TypeRef { - let vec[TypeRef] atys = vec(); + let vec[TypeRef] atys = []; // Arg 0: Output pointer. if (ty::type_has_dynamic_size(cx.tcx, output)) { - atys += vec(T_typaram_ptr(cx.tn)); + atys += [T_typaram_ptr(cx.tn)]; } else { - atys += vec(T_ptr(type_of_inner(cx, output))); + atys += [T_ptr(type_of_inner(cx, output))]; } // Arg 1: task pointer. - atys += vec(T_taskptr(cx.tn)); + atys += [T_taskptr(cx.tn)]; // Arg 2: Env (closure-bindings / self-obj) alt (obj_self) { case (some[TypeRef](?t)) { assert (t as int != 0); - atys += vec(t); + atys += [t]; } case (_) { - atys += vec(T_opaque_closure_ptr(cx.tn)); + atys += [T_opaque_closure_ptr(cx.tn)]; } } @@ -696,7 +696,7 @@ fn type_of_fn_full(&@crate_ctxt cx, if (obj_self == none[TypeRef]) { auto i = 0u; while (i < ty_param_count) { - atys += vec(T_ptr(T_tydesc(cx.tn))); + atys += [T_ptr(T_tydesc(cx.tn))]; i += 1u; } } @@ -706,11 +706,11 @@ fn type_of_fn_full(&@crate_ctxt cx, // *input* type of the function we're given as our iter-block // argument. atys += - vec(T_fn_pair(cx.tn, + [T_fn_pair(cx.tn, type_of_fn_full(cx, ast::proto_fn, none[TypeRef], - vec(rec(mode=ty::mo_alias, - ty=output)), - ty::mk_nil(cx.tcx), 0u))); + [rec(mode=ty::mo_alias, + ty=output)], + ty::mk_nil(cx.tcx), 0u))]; } // ... then explicit args. @@ -732,13 +732,13 @@ fn type_of_native_fn(&@crate_ctxt cx, ast::native_abi abi, &vec[ty::arg] inputs, &ty::t output, uint ty_param_count) -> TypeRef { - let vec[TypeRef] atys = vec(); + let vec[TypeRef] atys = []; if (abi == ast::native_abi_rust) { - atys += vec(T_taskptr(cx.tn)); + atys += [T_taskptr(cx.tn)]; auto t = ty::ty_native_fn(abi, inputs, output); auto i = 0u; while (i < ty_param_count) { - atys += vec(T_ptr(T_tydesc(cx.tn))); + atys += [T_ptr(T_tydesc(cx.tn))]; i += 1u; } } @@ -798,16 +798,16 @@ fn type_of_inner(&@crate_ctxt cx, &ty::t t) -> TypeRef { llty = T_ptr(T_chan(type_of_inner(cx, t))); } case (ty::ty_tup(?elts)) { - let vec[TypeRef] tys = vec(); + let vec[TypeRef] tys = []; for (ty::mt elt in elts) { - tys += vec(type_of_inner(cx, elt.ty)); + tys += [type_of_inner(cx, elt.ty)]; } llty = T_struct(tys); } case (ty::ty_rec(?fields)) { - let vec[TypeRef] tys = vec(); + let vec[TypeRef] tys = []; for (ty::field f in fields) { - tys += vec(type_of_inner(cx, f.mt.ty)); + tys += [type_of_inner(cx, f.mt.ty)]; } llty = T_struct(tys); } @@ -822,17 +822,17 @@ fn type_of_inner(&@crate_ctxt cx, &ty::t t) -> TypeRef { auto th = mk_type_handle(); auto self_ty = llvm::LLVMResolveTypeHandle(th.llth); - let vec[TypeRef] mtys = vec(T_ptr(T_i8())); + let vec[TypeRef] mtys = [T_ptr(T_i8())]; for (ty::method m in meths) { let TypeRef mty = type_of_fn_full(cx, m.proto, some[TypeRef](self_ty), m.inputs, m.output, 0u); - mtys += vec(T_ptr(mty)); + mtys += [T_ptr(mty)]; } let TypeRef vtbl = T_struct(mtys); - let TypeRef pair = T_struct(vec(T_ptr(vtbl), - T_opaque_obj_ptr(cx.tn))); + let TypeRef pair = T_struct([T_ptr(vtbl), + T_opaque_obj_ptr(cx.tn)]); auto abs_pair = llvm::LLVMResolveTypeHandle(th.llth); llvm::LLVMRefineType(abs_pair, pair); @@ -917,7 +917,7 @@ fn sanitize(&str s) -> str { if (c != 10u8 && c != ('}' as u8) && c != (')' as u8) && c != (' ' as u8) && c != ('\t' as u8) && c != (';' as u8)) { - auto v = vec(c); + auto v = [c]; result += _str::from_bytes(v); } } @@ -987,12 +987,12 @@ fn C_cstr(&@crate_ctxt cx, &str s) -> ValueRef { // A rust boxed-and-length-annotated string. fn C_str(&@crate_ctxt cx, &str s) -> ValueRef { auto len = _str::byte_len(s); - auto box = C_struct(vec(C_int(abi::const_refcount as int), + auto box = C_struct([C_int(abi::const_refcount as int), C_int(len + 1u as int), // 'alloc' C_int(len + 1u as int), // 'fill' C_int(0), // 'pad' llvm::LLVMConstString(_str::buf(s), - len, False))); + len, False)]); auto g = llvm::LLVMAddGlobal(cx.llmod, val_ty(box), _str::buf(cx.names.next("str"))); llvm::LLVMSetInitializer(g, box); @@ -1004,9 +1004,9 @@ fn C_str(&@crate_ctxt cx, &str s) -> ValueRef { fn C_zero_byte_arr(uint size) -> ValueRef { auto i = 0u; - let vec[ValueRef] elts = vec(); + let vec[ValueRef] elts = []; while (i < size) { - elts += vec(C_u8(0u)); + elts += [C_u8(0u)]; i += 1u; } ret llvm::LLVMConstArray(T_i8(), _vec::buf[ValueRef](elts), @@ -1050,7 +1050,7 @@ fn decl_internal_fastcall_fn(ModuleRef llmod, } fn decl_glue(ModuleRef llmod, type_names tn, &str s) -> ValueRef { - ret decl_cdecl_fn(llmod, s, T_fn(vec(T_taskptr(tn)), T_void())); + ret decl_cdecl_fn(llmod, s, T_fn([T_taskptr(tn)], T_void())); } fn decl_native_glue(ModuleRef llmod, &type_names tn, @@ -1068,10 +1068,10 @@ fn decl_native_glue(ModuleRef llmod, &type_names tn, // to call them directly, once we have a calling convention worked out. let int n = _n as int; let str s = abi::native_glue_name(n, ngt); - let vec[TypeRef] args = vec(T_int()); // callee + let vec[TypeRef] args = [T_int()]; // callee if (!pass_task) { - args += vec(T_int()); // taskptr, will not be passed + args += [T_int()]; // taskptr, will not be passed } args += _vec::init_elt[TypeRef](T_int(), n as uint); @@ -1123,14 +1123,14 @@ fn trans_native_call(&builder b, @glue_fns glues, ValueRef lltaskptr, } else { llglue = glues.native_glues_cdecl.(n); } - let vec[ValueRef] call_args = vec(llnative); + let vec[ValueRef] call_args = [llnative]; if (!pass_task) { - call_args += vec(lltaskptr); + call_args += [lltaskptr]; } for (ValueRef a in args) { - call_args += vec(b.ZExtOrBitCast(a, T_int())); + call_args += [b.ZExtOrBitCast(a, T_int())]; } ret b.FastCall(llglue, call_args); @@ -1138,8 +1138,8 @@ fn trans_native_call(&builder b, @glue_fns glues, ValueRef lltaskptr, fn trans_non_gc_free(&@block_ctxt cx, ValueRef v) -> result { cx.build.Call(cx.fcx.lcx.ccx.upcalls.free, - vec(cx.fcx.lltaskptr, - cx.build.PointerCast(v, T_ptr(T_i8())), C_int(0))); + [cx.fcx.lltaskptr, + cx.build.PointerCast(v, T_ptr(T_i8())), C_int(0)]); ret res(cx, C_int(0)); } @@ -1322,16 +1322,16 @@ fn dynamic_size_of(&@block_ctxt cx, ty::t t) -> result { ret res(szptr.bcx, szptr.bcx.build.Load(szptr.val)); } case (ty::ty_tup(?elts)) { - let vec[ty::t] tys = vec(); + let vec[ty::t] tys = []; for (ty::mt mt in elts) { - tys += vec(mt.ty); + tys += [mt.ty]; } ret align_elements(cx, tys); } case (ty::ty_rec(?flds)) { - let vec[ty::t] tys = vec(); + let vec[ty::t] tys = []; for (ty::field f in flds) { - tys += vec(f.mt.ty); + tys += [f.mt.ty]; } ret align_elements(cx, tys); } @@ -1346,13 +1346,13 @@ fn dynamic_size_of(&@block_ctxt cx, ty::t t) -> result { for (variant_info variant in variants) { // Perform type substitution on the raw argument types. let vec[ty::t] raw_tys = variant.args; - let vec[ty::t] tys = vec(); + let vec[ty::t] tys = []; for (ty::t raw_ty in raw_tys) { auto t = ty::bind_params_in_type(cx.fcx.lcx.ccx.tcx, raw_ty); t = ty::substitute_type_params(cx.fcx.lcx.ccx.tcx, tps, t); - tys += vec(t); + tys += [t]; } auto rslt = align_elements(bcx, tys); @@ -1417,9 +1417,9 @@ fn GEP_tup_like(&@block_ctxt cx, &ty::t t, // It might be a static-known type. Handle this. if (! ty::type_has_dynamic_size(cx.fcx.lcx.ccx.tcx, t)) { - let vec[ValueRef] v = vec(); + let vec[ValueRef] v = []; for (int i in ixs) { - v += vec(C_int(i)); + v += [C_int(i)]; } ret res(cx, cx.build.GEP(base, v)); } @@ -1463,7 +1463,7 @@ fn GEP_tup_like(&@block_ctxt cx, &ty::t t, assert (n < len); let int ix = ixs.(n); - let vec[ty::t] prefix = vec(); + let vec[ty::t] prefix = []; let int i = 0; while (i < ix) { _vec::push[ty::t](prefix, @@ -1497,7 +1497,7 @@ fn GEP_tup_like(&@block_ctxt cx, &ty::t t, auto sz = size_of(bcx, prefix_ty); bcx = sz.bcx; auto raw = bcx.build.PointerCast(base, T_ptr(T_i8())); - auto bumped = bcx.build.GEP(raw, vec(sz.val)); + auto bumped = bcx.build.GEP(raw, [sz.val]); if (ty::type_has_dynamic_size(cx.fcx.lcx.ccx.tcx, s.target)) { ret res(bcx, bumped); @@ -1525,12 +1525,12 @@ fn GEP_tag(@block_ctxt cx, auto arg_tys = variant.args; auto elem_ty = ty::mk_nil(cx.fcx.lcx.ccx.tcx); // typestate infelicity auto i = 0; - let vec[ty::t] true_arg_tys = vec(); + let vec[ty::t] true_arg_tys = []; for (ty::t aty in arg_tys) { auto arg_ty = ty::bind_params_in_type(cx.fcx.lcx.ccx.tcx, aty); arg_ty = ty::substitute_type_params(cx.fcx.lcx.ccx.tcx, ty_substs, arg_ty); - true_arg_tys += vec(arg_ty); + true_arg_tys += [arg_ty]; if (i == ix) { elem_ty = arg_ty; } @@ -1551,7 +1551,7 @@ fn GEP_tag(@block_ctxt cx, } // Do the GEP_tup_like(). - auto rslt = GEP_tup_like(cx, tup_ty, llunionptr, vec(0, ix)); + auto rslt = GEP_tup_like(cx, tup_ty, llunionptr, [0, ix]); // Cast the result to the appropriate type, if necessary. auto val; @@ -1571,7 +1571,7 @@ fn trans_raw_malloc(&@block_ctxt cx, TypeRef llptr_ty, ValueRef llsize) // FIXME: need a table to collect tydesc globals. auto tydesc = C_null(T_ptr(T_tydesc(cx.fcx.lcx.ccx.tn))); auto rval = cx.build.Call(cx.fcx.lcx.ccx.upcalls.malloc, - vec(cx.fcx.lltaskptr, llsize, tydesc)); + [cx.fcx.lltaskptr, llsize, tydesc]); ret res(cx, cx.build.PointerCast(rval, llptr_ty)); } @@ -1579,7 +1579,7 @@ fn trans_malloc_boxed(&@block_ctxt cx, ty::t t) -> result { // Synthesize a fake box type structurally so we have something // to measure the size of. auto boxed_body = ty::mk_imm_tup(cx.fcx.lcx.ccx.tcx, - vec(ty::mk_int(cx.fcx.lcx.ccx.tcx), t)); + [ty::mk_int(cx.fcx.lcx.ccx.tcx), t]); auto box_ptr = ty::mk_imm_box(cx.fcx.lcx.ccx.tcx, t); auto sz = size_of(cx, boxed_body); auto llty = type_of(cx.fcx.lcx.ccx, box_ptr); @@ -1597,7 +1597,7 @@ fn field_of_tydesc(&@block_ctxt cx, &ty::t t, bool escapes, int field) auto ti = none[@tydesc_info]; auto tydesc = get_tydesc(cx, t, escapes, ti); ret res(tydesc.bcx, - tydesc.bcx.build.GEP(tydesc.val, vec(C_int(0), C_int(field)))); + tydesc.bcx.build.GEP(tydesc.val, [C_int(0), C_int(field)])); } // Given a type containing ty params, build a vector containing a ValueRef for @@ -1606,8 +1606,8 @@ fn field_of_tydesc(&@block_ctxt cx, &ty::t t, bool escapes, int field) // constructing derived tydescs. fn linearize_ty_params(&@block_ctxt cx, &ty::t t) -> tup(vec[uint], vec[ValueRef]) { - let vec[ValueRef] param_vals = vec(); - let vec[uint] param_defs = vec(); + let vec[ValueRef] param_vals = []; + let vec[uint] param_defs = []; type rr = rec(@block_ctxt cx, mutable vec[ValueRef] vals, mutable vec[uint] defs); @@ -1622,8 +1622,8 @@ fn linearize_ty_params(&@block_ctxt cx, &ty::t t) -> } } if (!seen) { - r.vals += vec(r.cx.fcx.lltydescs.(pid)); - r.defs += vec(pid); + r.vals += [r.cx.fcx.lltydescs.(pid)]; + r.defs += [pid]; } } case (_) { } @@ -1654,7 +1654,7 @@ fn trans_stack_local_derived_tydesc(&@block_ctxt cx, ValueRef llsz, // Store a pointer to the rest of the descriptors. auto llrootfirstparam = cx.build.GEP(llmyroottydesc, - vec(C_int(0), C_int(0))); + [C_int(0), C_int(0)]); auto llfirstparam; alt (llparamtydescs) { @@ -1663,16 +1663,16 @@ fn trans_stack_local_derived_tydesc(&@block_ctxt cx, ValueRef llsz, } case (some[ValueRef](?llparamtydescs)) { llfirstparam = cx.build.GEP(llparamtydescs, - vec(C_int(0), C_int(0))); + [C_int(0), C_int(0)]); } } cx.build.Store(llfirstparam, - cx.build.GEP(llmyroottydesc, vec(C_int(0), C_int(0)))); + cx.build.GEP(llmyroottydesc, [C_int(0), C_int(0)])); cx.build.Store(llsz, - cx.build.GEP(llmyroottydesc, vec(C_int(0), C_int(1)))); + cx.build.GEP(llmyroottydesc, [C_int(0), C_int(1)])); cx.build.Store(llalign, - cx.build.GEP(llmyroottydesc, vec(C_int(0), C_int(2)))); + cx.build.GEP(llmyroottydesc, [C_int(0), C_int(2)])); ret llmyroottydesc; } @@ -1715,11 +1715,11 @@ fn get_derived_tydesc(&@block_ctxt cx, &ty::t t, bool escapes, 1u /* for root*/ + n_params)); auto i = 0; - auto tdp = bcx.build.GEP(tydescs, vec(C_int(0), C_int(i))); + auto tdp = bcx.build.GEP(tydescs, [C_int(0), C_int(i)]); bcx.build.Store(root, tdp); i += 1; for (ValueRef td in tys._1) { - auto tdp = bcx.build.GEP(tydescs, vec(C_int(0), C_int(i))); + auto tdp = bcx.build.GEP(tydescs, [C_int(0), C_int(i)]); bcx.build.Store(td, tdp); i += 1; } @@ -1727,12 +1727,12 @@ fn get_derived_tydesc(&@block_ctxt cx, &ty::t t, bool escapes, auto lltydescsptr = bcx.build.PointerCast(tydescs, T_ptr(T_ptr(T_tydesc(bcx.fcx.lcx.ccx.tn)))); auto td_val = bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.get_type_desc, - vec(bcx.fcx.lltaskptr, + [bcx.fcx.lltaskptr, bcx.fcx.lcx.ccx.crate_ptr, sz.val, align.val, C_int((1u + n_params) as int), - lltydescsptr)); + lltydescsptr]); v = td_val; } else { auto llparamtydescs_opt; @@ -1745,7 +1745,7 @@ fn get_derived_tydesc(&@block_ctxt cx, &ty::t t, bool escapes, auto i = 0; for (ValueRef td in tys._1) { auto tdp = bcx.build.GEP(llparamtydescs, - vec(C_int(0), C_int(i))); + [C_int(0), C_int(i)]); bcx.build.Store(td, tdp); i += 1; } @@ -1777,7 +1777,7 @@ fn get_tydesc(&@block_ctxt cx, &ty::t t, bool escapes, } // Otherwise, generate a tydesc if necessary, and return it. - let vec[uint] tps = vec(); + let vec[uint] tps = []; auto info = get_static_tydesc(cx, t, tps); static_ti = some[@tydesc_info](info); ret res(cx, info.tydesc); @@ -1901,7 +1901,7 @@ fn make_generic_glue(&@local_ctxt cx, auto p = 0u; while (p < ty_param_count) { auto llparam = copy_args_bcx.build.GEP(lltyparams, - vec(C_int(p as int))); + [C_int(p as int)]); llparam = copy_args_bcx.build.Load(llparam); _vec::grow_set[ValueRef](lltydescs, ty_params.(p), 0 as ValueRef, llparam); @@ -1977,7 +1977,7 @@ fn emit_tydescs(&@crate_ctxt ccx) { }; - auto tydesc = C_struct(vec(C_null(T_ptr(T_ptr(T_tydesc(ccx.tn)))), + auto tydesc = C_struct([C_null(T_ptr(T_ptr(T_tydesc(ccx.tn)))), ti.size, ti.align, take_glue, // take_glue @@ -1987,7 +1987,7 @@ fn emit_tydescs(&@crate_ctxt ccx) { C_null(glue_fn_ty), // mark_glue C_null(glue_fn_ty), // obj_drop_glue C_null(glue_fn_ty), // is_stateful - cmp_glue)); // cmp_glue + cmp_glue]); // cmp_glue auto gvar = ti.tydesc; llvm::LLVMSetInitializer(gvar, tydesc); @@ -2014,8 +2014,8 @@ fn make_take_glue(&@block_ctxt cx, ValueRef v, &ty::t t) { } fn incr_refcnt_of_boxed(&@block_ctxt cx, ValueRef box_ptr) -> result { - auto rc_ptr = cx.build.GEP(box_ptr, vec(C_int(0), - C_int(abi::box_rc_field_refcnt))); + auto rc_ptr = cx.build.GEP(box_ptr, [C_int(0), + C_int(abi::box_rc_field_refcnt)]); auto rc = cx.build.Load(rc_ptr); auto rc_adj_cx = new_sub_block_ctxt(cx, "rc++"); @@ -2063,8 +2063,8 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) { fn hit_zero(&@block_ctxt cx, ValueRef v, ty::t body_ty) -> result { auto body = cx.build.GEP(v, - vec(C_int(0), - C_int(abi::box_rc_field_body))); + [C_int(0), + C_int(abi::box_rc_field_body)]); auto body_val = load_if_immediate(cx, body, body_ty); auto res = drop_ty(cx, body_val, body_ty); @@ -2081,8 +2081,8 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) { case (ty::ty_port(_)) { fn hit_zero(&@block_ctxt cx, ValueRef v) -> result { cx.build.Call(cx.fcx.lcx.ccx.upcalls.del_port, - vec(cx.fcx.lltaskptr, - cx.build.PointerCast(v, T_opaque_port_ptr()))); + [cx.fcx.lltaskptr, + cx.build.PointerCast(v, T_opaque_port_ptr())]); ret res(cx, C_int(0)); } auto v = cx.build.Load(v0); @@ -2095,8 +2095,8 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) { case (ty::ty_chan(_)) { fn hit_zero(&@block_ctxt cx, ValueRef v) -> result { cx.build.Call(cx.fcx.lcx.ccx.upcalls.del_chan, - vec(cx.fcx.lltaskptr, - cx.build.PointerCast(v, T_opaque_chan_ptr()))); + [cx.fcx.lltaskptr, + cx.build.PointerCast(v, T_opaque_chan_ptr())]); ret res(cx, C_int(0)); } auto v = cx.build.Load(v0); @@ -2110,12 +2110,12 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) { fn hit_zero(&@block_ctxt cx, ValueRef b, ValueRef o) -> result { auto body = cx.build.GEP(b, - vec(C_int(0), - C_int(abi::box_rc_field_body))); + [C_int(0), + C_int(abi::box_rc_field_body)]); auto tydescptr = cx.build.GEP(body, - vec(C_int(0), - C_int(abi::obj_body_elt_tydesc))); + [C_int(0), + C_int(abi::obj_body_elt_tydesc)]); auto tydesc = cx.build.Load(tydescptr); auto cx_ = maybe_call_dtor(cx, o); @@ -2131,8 +2131,8 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) { } auto box_cell = cx.build.GEP(v0, - vec(C_int(0), - C_int(abi::obj_field_box))); + [C_int(0), + C_int(abi::obj_field_box)]); auto boxptr = cx.build.Load(box_cell); @@ -2148,17 +2148,17 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) { // Call through the closure's own fields-drop glue first. auto body = cx.build.GEP(v, - vec(C_int(0), - C_int(abi::box_rc_field_body))); + [C_int(0), + C_int(abi::box_rc_field_body)]); auto bindings = cx.build.GEP(body, - vec(C_int(0), - C_int(abi::closure_elt_bindings))); + [C_int(0), + C_int(abi::closure_elt_bindings)]); auto tydescptr = cx.build.GEP(body, - vec(C_int(0), - C_int(abi::closure_elt_tydesc))); + [C_int(0), + C_int(abi::closure_elt_tydesc)]); auto ti = none[@tydesc_info]; call_tydesc_glue_full(cx, bindings, cx.build.Load(tydescptr), @@ -2171,8 +2171,8 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) { } auto box_cell = cx.build.GEP(v0, - vec(C_int(0), - C_int(abi::fn_field_box))); + [C_int(0), + C_int(abi::fn_field_box)]); auto boxptr = cx.build.Load(box_cell); @@ -2216,8 +2216,8 @@ fn decr_refcnt_and_if_zero(&@block_ctxt cx, auto rc_ptr = load_rc_cx.build.GEP(box_ptr, - vec(C_int(0), - C_int(abi::box_rc_field_refcnt))); + [C_int(0), + C_int(abi::box_rc_field_refcnt)]); auto rc = load_rc_cx.build.Load(rc_ptr); auto const_test = @@ -2234,11 +2234,11 @@ fn decr_refcnt_and_if_zero(&@block_ctxt cx, inner_res.bcx.build.Br(next_cx.llbb); auto phi = next_cx.build.Phi(t_else, - vec(v_else, v_else, v_else, inner_res.val), - vec(cx.llbb, + [v_else, v_else, v_else, inner_res.val], + [cx.llbb, load_rc_cx.llbb, rc_adj_cx.llbb, - inner_res.bcx.llbb)); + inner_res.bcx.llbb]); ret res(next_cx, phi); } @@ -2263,8 +2263,8 @@ fn make_cmp_glue(&@block_ctxt cx, make_scalar_cmp_glue(cx, lhs, rhs, t, llop); } else if (ty::type_is_box(cx.fcx.lcx.ccx.tcx, t)) { - lhs = cx.build.GEP(lhs, vec(C_int(0), C_int(abi::box_rc_field_body))); - rhs = cx.build.GEP(rhs, vec(C_int(0), C_int(abi::box_rc_field_body))); + lhs = cx.build.GEP(lhs, [C_int(0), C_int(abi::box_rc_field_body)]); + rhs = cx.build.GEP(rhs, [C_int(0), C_int(abi::box_rc_field_body)]); auto t_inner = alt (ty::struct(cx.fcx.lcx.ccx.tcx, t)) { case (ty::ty_box(?ti)) { ti.ty } }; @@ -2378,7 +2378,7 @@ fn make_cmp_glue(&@block_ctxt cx, auto rhs_p0 = vec_p0(r.bcx, rhs); auto min_len = umin(r.bcx, vec_fill(r.bcx, lhs), vec_fill(r.bcx, rhs)); - auto rhs_lim = r.bcx.build.GEP(rhs_p0, vec(min_len)); + auto rhs_lim = r.bcx.build.GEP(rhs_p0, [min_len]); auto elt_ty = ty::sequence_element_type(cx.fcx.lcx.ccx.tcx, t); r = size_of(r.bcx, elt_ty); r = iter_sequence_raw(r.bcx, lhs_p0, rhs_p0, rhs_lim, r.val, @@ -2452,8 +2452,8 @@ fn make_fp_cmp_glue(&@block_ctxt cx, ValueRef lhs, ValueRef rhs, llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_le), le_cx.llbb); auto last_result = - last_cx.build.Phi(T_i1(), vec(eq_result, lt_result, le_result), - vec(eq_cx.llbb, lt_cx.llbb, le_cx.llbb)); + last_cx.build.Phi(T_i1(), [eq_result, lt_result, le_result], + [eq_cx.llbb, lt_cx.llbb, le_cx.llbb]); last_cx.build.Store(last_result, cx.fcx.llretptr); last_cx.build.RetVoid(); } @@ -2494,8 +2494,8 @@ fn compare_integral_values(&@block_ctxt cx, ValueRef lhs, ValueRef rhs, llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_le), le_cx.llbb); auto last_result = - last_cx.build.Phi(T_i1(), vec(eq_result, lt_result, le_result), - vec(eq_cx.llbb, lt_cx.llbb, le_cx.llbb)); + last_cx.build.Phi(T_i1(), [eq_result, lt_result, le_result], + [eq_cx.llbb, lt_cx.llbb, le_cx.llbb]); ret res(last_cx, last_result); } @@ -2522,17 +2522,17 @@ fn tag_variants(&@crate_ctxt cx, &ast::def_id id) -> vec[variant_info] { assert (cx.items.contains_key(id)); alt (cx.items.get(id).node) { case (ast::item_tag(_, ?variants, _, _, _)) { - let vec[variant_info] result = vec(); + let vec[variant_info] result = []; for (ast::variant variant in variants) { auto ctor_ty = node_ann_type(cx, variant.node.ann); - let vec[ty::t] arg_tys = vec(); + let vec[ty::t] arg_tys = []; if (_vec::len[ast::variant_arg](variant.node.args) > 0u) { for (ty::arg a in ty::ty_fn_args(cx.tcx, ctor_ty)) { - arg_tys += vec(a.ty); + arg_tys += [a.ty]; } } auto did = variant.node.id; - result += vec(rec(args=arg_tys, ctor_ty=ctor_ty, id=did)); + result += [rec(args=arg_tys, ctor_ty=ctor_ty, id=did)]; } ret result; } @@ -2616,9 +2616,9 @@ fn iter_structural_ty_full(&@block_ctxt cx, case (ty::ty_tup(?args)) { let int i = 0; for (ty::mt arg in args) { - r = GEP_tup_like(r.bcx, t, av, vec(0, i)); + r = GEP_tup_like(r.bcx, t, av, [0, i]); auto elt_a = r.val; - r = GEP_tup_like(r.bcx, t, bv, vec(0, i)); + r = GEP_tup_like(r.bcx, t, bv, [0, i]); auto elt_b = r.val; r = f(r.bcx, load_if_immediate(r.bcx, elt_a, arg.ty), @@ -2630,9 +2630,9 @@ fn iter_structural_ty_full(&@block_ctxt cx, case (ty::ty_rec(?fields)) { let int i = 0; for (ty::field fld in fields) { - r = GEP_tup_like(r.bcx, t, av, vec(0, i)); + r = GEP_tup_like(r.bcx, t, av, [0, i]); auto llfld_a = r.val; - r = GEP_tup_like(r.bcx, t, bv, vec(0, i)); + r = GEP_tup_like(r.bcx, t, bv, [0, i]); auto llfld_b = r.val; r = f(r.bcx, load_if_immediate(r.bcx, llfld_a, fld.mt.ty), @@ -2651,15 +2651,15 @@ fn iter_structural_ty_full(&@block_ctxt cx, auto bv_tag = cx.build.PointerCast(bv, lltagty); auto lldiscrim_a_ptr = cx.build.GEP(av_tag, - vec(C_int(0), C_int(0))); + [C_int(0), C_int(0)]); auto llunion_a_ptr = cx.build.GEP(av_tag, - vec(C_int(0), C_int(1))); + [C_int(0), C_int(1)]); auto lldiscrim_a = cx.build.Load(lldiscrim_a_ptr); auto lldiscrim_b_ptr = cx.build.GEP(bv_tag, - vec(C_int(0), C_int(0))); + [C_int(0), C_int(0)]); auto llunion_b_ptr = cx.build.GEP(bv_tag, - vec(C_int(0), C_int(1))); + [C_int(0), C_int(1)]); auto lldiscrim_b = cx.build.Load(lldiscrim_b_ptr); // NB: we must hit the discriminant first so that structural @@ -2690,7 +2690,7 @@ fn iter_structural_ty_full(&@block_ctxt cx, case (ty::ty_fn(_, ?args, _)) { auto j = 0; for (ty::arg a in args) { - auto v = vec(C_int(0), C_int(j as int)); + auto v = [C_int(0), C_int(j as int)]; auto rslt = GEP_tag(variant_cx, llunion_a_ptr, tid, variant.id, tps, j); @@ -2740,23 +2740,23 @@ fn iter_structural_ty_full(&@block_ctxt cx, case (ty::ty_fn(_,_,_)) { auto box_cell_a = cx.build.GEP(av, - vec(C_int(0), - C_int(abi::fn_field_box))); + [C_int(0), + C_int(abi::fn_field_box)]); auto box_cell_b = cx.build.GEP(bv, - vec(C_int(0), - C_int(abi::fn_field_box))); + [C_int(0), + C_int(abi::fn_field_box)]); ret iter_boxpp(cx, box_cell_a, box_cell_b, f); } case (ty::ty_obj(_)) { auto box_cell_a = cx.build.GEP(av, - vec(C_int(0), - C_int(abi::obj_field_box))); + [C_int(0), + C_int(abi::obj_field_box)]); auto box_cell_b = cx.build.GEP(bv, - vec(C_int(0), - C_int(abi::obj_field_box))); + [C_int(0), + C_int(abi::obj_field_box)]); ret iter_boxpp(cx, box_cell_a, box_cell_b, f); } case (_) { @@ -2787,9 +2787,9 @@ fn iter_sequence_raw(@block_ctxt cx, bcx.build.Br(cond_cx.llbb); let ValueRef dst_curr = cond_cx.build.Phi(T_int(), - vec(dst_int), vec(bcx.llbb)); + [dst_int], [bcx.llbb]); let ValueRef src_curr = cond_cx.build.Phi(T_int(), - vec(src_int), vec(bcx.llbb)); + [src_int], [bcx.llbb]); auto end_test = cond_cx.build.ICmp(lib::llvm::LLVMIntULT, src_curr, src_lim_int); @@ -2806,10 +2806,10 @@ fn iter_sequence_raw(@block_ctxt cx, auto src_next = body_cx.build.Add(src_curr, elt_sz); body_cx.build.Br(cond_cx.llbb); - cond_cx.build.AddIncomingToPhi(dst_curr, vec(dst_next), - vec(body_cx.llbb)); - cond_cx.build.AddIncomingToPhi(src_curr, vec(src_next), - vec(body_cx.llbb)); + cond_cx.build.AddIncomingToPhi(dst_curr, [dst_next], + [body_cx.llbb]); + cond_cx.build.AddIncomingToPhi(src_curr, [src_next], + [body_cx.llbb]); ret res(next_cx, C_nil()); } @@ -2855,10 +2855,10 @@ fn iter_sequence(@block_ctxt cx, &val_and_ty_fn f, bool trailing_null) -> result { - auto p0 = cx.build.GEP(v, vec(C_int(0), - C_int(abi::vec_elt_data))); - auto lenptr = cx.build.GEP(v, vec(C_int(0), - C_int(abi::vec_elt_fill))); + auto p0 = cx.build.GEP(v, [C_int(0), + C_int(abi::vec_elt_data)]); + auto lenptr = cx.build.GEP(v, [C_int(0), + C_int(abi::vec_elt_fill)]); auto llunit_ty; if (ty::type_has_dynamic_size(cx.fcx.lcx.ccx.tcx, elt_ty)) { @@ -2993,17 +2993,17 @@ fn call_tydesc_glue_full(&@block_ctxt cx, ValueRef v, auto llrawptr = cx.build.BitCast(v, T_ptr(T_i8())); auto lltydescs = cx.build.GEP(tydesc, - vec(C_int(0), - C_int(abi::tydesc_field_first_param))); + [C_int(0), + C_int(abi::tydesc_field_first_param)]); lltydescs = cx.build.Load(lltydescs); - auto llfnptr = cx.build.GEP(tydesc, vec(C_int(0), C_int(field))); + auto llfnptr = cx.build.GEP(tydesc, [C_int(0), C_int(field)]); auto llfn = cx.build.Load(llfnptr); - cx.build.FastCall(llfn, vec(C_null(T_ptr(T_nil())), + cx.build.FastCall(llfn, [C_null(T_ptr(T_nil())), cx.fcx.lltaskptr, C_null(T_ptr(T_nil())), lltydescs, - llrawptr)); + llrawptr]); } fn call_tydesc_glue(&@block_ctxt cx, ValueRef v, @@ -3019,9 +3019,9 @@ fn call_tydesc_glue(&@block_ctxt cx, ValueRef v, } fn maybe_call_dtor(&@block_ctxt cx, ValueRef v) -> @block_ctxt { - auto vtbl = cx.build.GEP(v, vec(C_int(0), C_int(abi::obj_field_vtbl))); + auto vtbl = cx.build.GEP(v, [C_int(0), C_int(abi::obj_field_vtbl)]); vtbl = cx.build.Load(vtbl); - auto dtor_ptr = cx.build.GEP(vtbl, vec(C_int(0), C_int(0))); + auto dtor_ptr = cx.build.GEP(vtbl, [C_int(0), C_int(0)]); dtor_ptr = cx.build.Load(dtor_ptr); auto self_t = llvm::LLVMGetElementType(val_ty(v)); dtor_ptr = cx.build.BitCast(dtor_ptr, @@ -3034,8 +3034,8 @@ fn maybe_call_dtor(&@block_ctxt cx, ValueRef v) -> @block_ctxt { cx.build.CondBr(test, dtor_cx.llbb, after_cx.llbb); auto me = dtor_cx.build.Load(v); - dtor_cx.build.FastCall(dtor_ptr, vec(C_null(T_ptr(T_nil())), - cx.fcx.lltaskptr, me)); + dtor_cx.build.FastCall(dtor_ptr, [C_null(T_ptr(T_nil())), + cx.fcx.lltaskptr, me]); dtor_cx.build.Br(after_cx.llbb); ret after_cx; } @@ -3060,23 +3060,23 @@ fn call_cmp_glue(&@block_ctxt cx, lazily_emit_tydesc_glue(cx, abi::tydesc_field_cmp_glue, ti); auto lltydescs = - r.bcx.build.GEP(r.val, vec(C_int(0), - C_int(abi::tydesc_field_first_param))); + r.bcx.build.GEP(r.val, [C_int(0), + C_int(abi::tydesc_field_first_param)]); lltydescs = r.bcx.build.Load(lltydescs); auto llfnptr = - r.bcx.build.GEP(r.val, vec(C_int(0), - C_int(abi::tydesc_field_cmp_glue))); + r.bcx.build.GEP(r.val, [C_int(0), + C_int(abi::tydesc_field_cmp_glue)]); auto llfn = r.bcx.build.Load(llfnptr); auto llcmpresultptr = r.bcx.build.Alloca(T_i1()); - let vec[ValueRef] llargs = vec(llcmpresultptr, + let vec[ValueRef] llargs = [llcmpresultptr, r.bcx.fcx.lltaskptr, C_null(T_ptr(T_nil())), lltydescs, llrawlhsptr, llrawrhsptr, - llop); + llop]; r.bcx.build.FastCall(llfn, llargs); @@ -3132,8 +3132,8 @@ fn call_memmove(&@block_ctxt cx, auto volatile = C_bool(false); ret res(cx, cx.build.Call(memmove, - vec(dst_ptr, src_ptr, - size, align, volatile))); + [dst_ptr, src_ptr, + size, align, volatile])); } fn call_bzero(&@block_ctxt cx, @@ -3155,8 +3155,8 @@ fn call_bzero(&@block_ctxt cx, auto volatile = C_bool(false); ret res(cx, cx.build.Call(memset, - vec(dst_ptr, C_u8(0u), - size, align, volatile))); + [dst_ptr, C_u8(0u), + size, align, volatile])); } fn memmove_ty(&@block_ctxt cx, @@ -3328,15 +3328,15 @@ fn trans_unary(&@block_ctxt cx, ast::unop op, auto box_ty = node_ann_type(sub.bcx.fcx.lcx.ccx, a); sub = trans_malloc_boxed(sub.bcx, e_ty); find_scope_cx(cx).cleanups += - vec(clean(bind drop_ty(_, sub.val, box_ty))); + [clean(bind drop_ty(_, sub.val, box_ty))]; auto box = sub.val; auto rc = sub.bcx.build.GEP(box, - vec(C_int(0), - C_int(abi::box_rc_field_refcnt))); + [C_int(0), + C_int(abi::box_rc_field_refcnt)]); auto body = sub.bcx.build.GEP(box, - vec(C_int(0), - C_int(abi::box_rc_field_body))); + [C_int(0), + C_int(abi::box_rc_field_body)]); sub.bcx.build.Store(C_int(1), rc); // Cast the body type to the type of the value. This is needed to @@ -3426,10 +3426,10 @@ fn trans_vec_append(&@block_ctxt cx, &ty::t t, auto src = bcx.build.PointerCast(rhs, T_opaque_vec_ptr()); ret res(bcx, bcx.build.FastCall(cx.fcx.lcx.ccx.glues.vec_append_glue, - vec(cx.fcx.lltaskptr, + [cx.fcx.lltaskptr, llvec_tydesc.val, llelt_tydesc.val, - dst, src, skip_null))); + dst, src, skip_null])); } fn trans_vec_add(&@block_ctxt cx, &ty::t t, @@ -3440,7 +3440,7 @@ fn trans_vec_add(&@block_ctxt cx, &ty::t t, auto bcx = trans_vec_append(r.bcx, t, tmp, rhs).bcx; tmp = load_if_immediate(bcx, tmp, t); find_scope_cx(cx).cleanups += - vec(clean(bind drop_ty(_, tmp, t))); + [clean(bind drop_ty(_, tmp, t))]; ret res(bcx, tmp); } @@ -3530,8 +3530,8 @@ fn autoderef(&@block_ctxt cx, ValueRef v, &ty::t t) -> result { alt (ty::struct(cx.fcx.lcx.ccx.tcx, t1)) { case (ty::ty_box(?mt)) { auto body = cx.build.GEP(v1, - vec(C_int(0), - C_int(abi::box_rc_field_body))); + [C_int(0), + C_int(abi::box_rc_field_body)]); t1 = mt.ty; // Since we're changing levels of box indirection, we may have @@ -3596,7 +3596,7 @@ fn trans_binary(&@block_ctxt cx, ast::binop op, lhs_false_cx.llbb); ret join_results(cx, T_bool(), - vec(lhs_false_res, rhs_res)); + [lhs_false_res, rhs_res]); } case (ast::or) { @@ -3620,7 +3620,7 @@ fn trans_binary(&@block_ctxt cx, ast::binop op, rhs_cx.llbb); ret join_results(cx, T_bool(), - vec(lhs_true_res, rhs_res)); + [lhs_true_res, rhs_res]); } case (_) { @@ -3645,15 +3645,15 @@ fn join_results(&@block_ctxt parent_cx, &vec[result] ins) -> result { - let vec[result] live = vec(); - let vec[ValueRef] vals = vec(); - let vec[BasicBlockRef] bbs = vec(); + let vec[result] live = []; + let vec[ValueRef] vals = []; + let vec[BasicBlockRef] bbs = []; for (result r in ins) { if (! is_terminated(r.bcx)) { - live += vec(r); - vals += vec(r.val); - bbs += vec(r.bcx.llbb); + live += [r]; + vals += [r.val]; + bbs += [r.bcx.llbb]; } } @@ -3730,7 +3730,7 @@ fn trans_if(&@block_ctxt cx, &@ast::expr cond, else_cx.llbb); ret join_results(cx, expr_llty, - vec(then_res, else_res)); + [then_res, else_res]); } fn trans_for(&@block_ctxt cx, @@ -3751,7 +3751,7 @@ fn trans_for(&@block_ctxt cx, auto local_res = alloc_local(scope_cx, local); auto bcx = copy_ty(local_res.bcx, INIT, local_res.val, curr, t).bcx; scope_cx.cleanups += - vec(clean(bind drop_slot(_, local_res.val, t))); + [clean(bind drop_slot(_, local_res.val, t))]; bcx = trans_block(bcx, body).bcx; bcx.build.Br(next_cx.llbb); ret res(next_cx, C_nil()); @@ -3814,7 +3814,7 @@ fn collect_upvars(&@block_ctxt cx, &ast::block bloc, } } - let vec[ast::def_id] refs = vec(); + let vec[ast::def_id] refs = []; let hashmap[ast::def_id,()] decls = new_def_hash[()](); decls.insert(initial_decl, ()); let env e = @rec(mutable refs=refs, @@ -3827,10 +3827,10 @@ fn collect_upvars(&@block_ctxt cx, &ast::block bloc, walk::walk_block(*visitor, bloc); // Calculate (refs - decls). This is the set of captured upvars. - let vec[ast::def_id] result = vec(); + let vec[ast::def_id] result = []; for (ast::def_id ref_id in e.refs) { if (!decls.contains_key(ref_id)) { - result += vec(ref_id); + result += [ref_id]; } } @@ -3884,8 +3884,8 @@ fn trans_for_each(&@block_ctxt cx, auto llbindingsptr; if (upvar_count > 0u) { // Gather up the upvars. - let vec[ValueRef] llbindings = vec(); - let vec[TypeRef] llbindingtys = vec(); + let vec[ValueRef] llbindings = []; + let vec[TypeRef] llbindingtys = []; for (ast::def_id did in upvars) { auto llbinding; alt (cx.fcx.lllocals.find(did)) { @@ -3899,8 +3899,8 @@ fn trans_for_each(&@block_ctxt cx, } case (some[ValueRef](?llval)) { llbinding = llval; } } - llbindings += vec(llbinding); - llbindingtys += vec(val_ty(llbinding)); + llbindings += [llbinding]; + llbindingtys += [val_ty(llbinding)]; } // Create an array of bindings and copy in aliases to the upvars. @@ -3908,7 +3908,7 @@ fn trans_for_each(&@block_ctxt cx, auto i = 0u; while (i < upvar_count) { auto llbindingptr = cx.build.GEP(llbindingsptr, - vec(C_int(0), C_int(i as int))); + [C_int(0), C_int(i as int)]); cx.build.Store(llbindings.(i), llbindingptr); i += 1u; } @@ -3924,21 +3924,21 @@ fn trans_for_each(&@block_ctxt cx, auto llenvptr = alloca(cx, llvm::LLVMGetElementType(llenvptrty)); auto llbindingsptrptr = cx.build.GEP(llenvptr, - vec(C_int(0), + [C_int(0), C_int(abi::box_rc_field_body), - C_int(2))); + C_int(2)]); cx.build.Store(llbindingsptr, llbindingsptrptr); // Copy in our type descriptors, in case the iterator body needs to refer // to them. auto lltydescsptr = cx.build.GEP(llenvptr, - vec(C_int(0), + [C_int(0), C_int(abi::box_rc_field_body), - C_int(abi::closure_elt_ty_params))); + C_int(abi::closure_elt_ty_params)]); auto i = 0u; while (i < tydesc_count) { auto lltydescptr = cx.build.GEP(lltydescsptr, - vec(C_int(0), C_int(i as int))); + [C_int(0), C_int(i as int)]); cx.build.Store(cx.fcx.lltydescs.(i), lltydescptr); i += 1u; } @@ -3956,7 +3956,7 @@ fn trans_for_each(&@block_ctxt cx, auto iter_body_llty = type_of_fn_full(lcx.ccx, ast::proto_fn, none[TypeRef], - vec(rec(mode=ty::mo_alias, ty=decl_ty)), + [rec(mode=ty::mo_alias, ty=decl_ty)], ty::mk_nil(lcx.ccx.tcx), 0u); let ValueRef lliterbody = decl_internal_fastcall_fn(lcx.ccx.llmod, @@ -3971,9 +3971,9 @@ fn trans_for_each(&@block_ctxt cx, llenvptrty); auto llremotebindingsptrptr = copy_args_bcx.build.GEP(llremoteenvptr, - vec(C_int(0), + [C_int(0), C_int(abi::box_rc_field_body), - C_int(abi::closure_elt_bindings))); + C_int(abi::closure_elt_bindings)]); auto llremotebindingsptr = copy_args_bcx.build.Load(llremotebindingsptrptr); @@ -3982,7 +3982,7 @@ fn trans_for_each(&@block_ctxt cx, auto upvar_id = upvars.(i); auto llupvarptrptr = copy_args_bcx.build.GEP(llremotebindingsptr, - vec(C_int(0), C_int(i as int))); + [C_int(0), C_int(i as int)]); auto llupvarptr = copy_args_bcx.build.Load(llupvarptrptr); fcx.llupvars.insert(upvar_id, llupvarptr); @@ -3992,17 +3992,17 @@ fn trans_for_each(&@block_ctxt cx, // Populate the type parameters from the environment. auto llremotetydescsptr = copy_args_bcx.build.GEP(llremoteenvptr, - vec(C_int(0), + [C_int(0), C_int(abi::box_rc_field_body), - C_int(abi::closure_elt_ty_params))); + C_int(abi::closure_elt_ty_params)]); i = 0u; while (i < tydesc_count) { auto llremotetydescptr = - copy_args_bcx.build.GEP(llremotetydescsptr, vec(C_int(0), - C_int(i as int))); + copy_args_bcx.build.GEP(llremotetydescsptr, [C_int(0), + C_int(i as int)]); auto llremotetydesc = copy_args_bcx.build.Load(llremotetydescptr); - fcx.lltydescs += vec(llremotetydesc); + fcx.lltydescs += [llremotetydesc]; i += 1u; } @@ -4027,12 +4027,12 @@ fn trans_for_each(&@block_ctxt cx, auto pair = alloca(cx, T_fn_pair(lcx.ccx.tn, iter_body_llty)); auto code_cell = cx.build.GEP(pair, - vec(C_int(0), - C_int(abi::fn_field_code))); + [C_int(0), + C_int(abi::fn_field_code)]); cx.build.Store(lliterbody, code_cell); - auto env_cell = cx.build.GEP(pair, vec(C_int(0), - C_int(abi::fn_field_box))); + auto env_cell = cx.build.GEP(pair, [C_int(0), + C_int(abi::fn_field_box)]); auto llenvblobptr = cx.build.PointerCast(llenvptr, T_opaque_closure_ptr(lcx.ccx.tn)); cx.build.Store(llenvblobptr, env_cell); @@ -4109,7 +4109,7 @@ fn trans_pat_match(&@block_ctxt cx, &@ast::pat pat, ValueRef llval, T_opaque_tag_ptr(cx.fcx.lcx.ccx.tn)); auto lldiscrimptr = cx.build.GEP(lltagptr, - vec(C_int(0), C_int(0))); + [C_int(0), C_int(0)]); auto lldiscrim = cx.build.Load(lldiscrimptr); auto vdef = ast::variant_def_ids @@ -4138,7 +4138,7 @@ fn trans_pat_match(&@block_ctxt cx, &@ast::pat pat, ValueRef llval, if (_vec::len[@ast::pat](subpats) > 0u) { auto llblobptr = matched_cx.build.GEP(lltagptr, - vec(C_int(0), C_int(1))); + [C_int(0), C_int(1)]); auto i = 0; for (@ast::pat subpat in subpats) { auto rslt = GEP_tag(matched_cx, llblobptr, vdef._0, @@ -4183,7 +4183,7 @@ fn trans_pat_binding(&@block_ctxt cx, &@ast::pat pat, maybe_name_value(cx.fcx.lcx.ccx, dst, id); bcx.fcx.lllocals.insert(def_id, dst); bcx.cleanups += - vec(clean(bind drop_slot(_, dst, t))); + [clean(bind drop_slot(_, dst, t))]; ret copy_ty(bcx, INIT, dst, llval, t); } } @@ -4196,7 +4196,7 @@ fn trans_pat_binding(&@block_ctxt cx, &@ast::pat pat, auto lltagptr = cx.build.PointerCast(llval, T_opaque_tag_ptr(cx.fcx.lcx.ccx.tn)); - auto llblobptr = cx.build.GEP(lltagptr, vec(C_int(0), C_int(1))); + auto llblobptr = cx.build.GEP(lltagptr, [C_int(0), C_int(1)]); auto ty_param_substs = ty::ann_to_type_params(cx.fcx.lcx.ccx.node_types, ann); @@ -4223,7 +4223,7 @@ fn trans_alt(&@block_ctxt cx, &@ast::expr expr, auto expr_res = trans_expr(cx, expr); auto this_cx = expr_res.bcx; - let vec[result] arm_results = vec(); + let vec[result] arm_results = []; for (ast::arm arm in arms) { auto next_cx = new_sub_block_ctxt(expr_res.bcx, "next"); auto match_res = trans_pat_match(this_cx, arm.pat, expr_res.val, @@ -4236,7 +4236,7 @@ fn trans_alt(&@block_ctxt cx, &@ast::expr expr, expr_res.val, false); auto block_res = trans_block(binding_res.bcx, arm.block); - arm_results += vec(block_res); + arm_results += [block_res]; this_cx = next_cx; } @@ -4325,13 +4325,13 @@ fn lval_generic_fn(&@block_ctxt cx, if (_vec::len[ty::t](tys) != 0u) { auto bcx = lv.res.bcx; - let vec[ValueRef] tydescs = vec(); - let vec[option::t[@tydesc_info]] tis = vec(); + let vec[ValueRef] tydescs = []; + let vec[option::t[@tydesc_info]] tis = []; for (ty::t t in tys) { // TODO: Doesn't always escape. auto ti = none[@tydesc_info]; auto td = get_tydesc(bcx, t, true, ti); - tis += vec(ti); + tis += [ti]; bcx = td.bcx; _vec::push[ValueRef](tydescs, td.val); } @@ -4438,7 +4438,7 @@ fn trans_path(&@block_ctxt cx, &ast::path p, &ast::ann ann) -> lval_result { PointerCast(lltagblob, T_ptr(lltagty)); auto lldiscrimptr = alloc_result.bcx.build.GEP - (lltagptr, vec(C_int(0), C_int(0))); + (lltagptr, [C_int(0), C_int(0)]); alloc_result.bcx.build.Store(lldiscrim, lldiscrimptr); @@ -4472,25 +4472,25 @@ fn trans_field(&@block_ctxt cx, &ast::span sp, ValueRef v, &ty::t t0, alt (ty::struct(cx.fcx.lcx.ccx.tcx, t)) { case (ty::ty_tup(_)) { let uint ix = ty::field_num(cx.fcx.lcx.ccx.sess, sp, field); - auto v = GEP_tup_like(r.bcx, t, r.val, vec(0, ix as int)); + auto v = GEP_tup_like(r.bcx, t, r.val, [0, ix as int]); ret lval_mem(v.bcx, v.val); } case (ty::ty_rec(?fields)) { let uint ix = ty::field_idx(cx.fcx.lcx.ccx.sess, sp, field, fields); - auto v = GEP_tup_like(r.bcx, t, r.val, vec(0, ix as int)); + auto v = GEP_tup_like(r.bcx, t, r.val, [0, ix as int]); ret lval_mem(v.bcx, v.val); } case (ty::ty_obj(?methods)) { let uint ix = ty::method_idx(cx.fcx.lcx.ccx.sess, sp, field, methods); auto vtbl = r.bcx.build.GEP(r.val, - vec(C_int(0), - C_int(abi::obj_field_vtbl))); + [C_int(0), + C_int(abi::obj_field_vtbl)]); vtbl = r.bcx.build.Load(vtbl); // +1 because slot #0 contains the destructor - auto v = r.bcx.build.GEP(vtbl, vec(C_int(0), - C_int((ix + 1u) as int))); + auto v = r.bcx.build.GEP(vtbl, [C_int(0), + C_int((ix + 1u) as int)]); auto lvo = lval_mem(r.bcx, v); let ty::t fn_ty = ty::method_ty_to_fn_ty(cx.fcx.lcx.ccx.tcx, @@ -4535,7 +4535,7 @@ fn trans_index(&@block_ctxt cx, &ast::span sp, &@ast::expr base, auto scaled_ix = bcx.build.Mul(ix_val, unit_sz.val); maybe_name_value(cx.fcx.lcx.ccx, scaled_ix, "scaled_ix"); - auto lim = bcx.build.GEP(v, vec(C_int(0), C_int(abi::vec_elt_fill))); + auto lim = bcx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_fill)]); lim = bcx.build.Load(lim); auto bounds_check = bcx.build.ICmp(lib::llvm::LLVMIntULT, @@ -4549,13 +4549,13 @@ fn trans_index(&@block_ctxt cx, &ast::span sp, &@ast::expr base, auto fail_res = trans_fail(fail_cx, some[common::span](sp), "bounds check"); - auto body = next_cx.build.GEP(v, vec(C_int(0), C_int(abi::vec_elt_data))); + auto body = next_cx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_data)]); auto elt; if (ty::type_has_dynamic_size(cx.fcx.lcx.ccx.tcx, unit_ty)) { body = next_cx.build.PointerCast(body, T_ptr(T_array(T_i8(), 1u))); - elt = next_cx.build.GEP(body, vec(C_int(0), scaled_ix)); + elt = next_cx.build.GEP(body, [C_int(0), scaled_ix]); } else { - elt = next_cx.build.GEP(body, vec(C_int(0), ix_val)); + elt = next_cx.build.GEP(body, [C_int(0), ix_val]); // We're crossing a box boundary here, so we may need to pointer cast. auto llunitty = type_of(next_cx.fcx.lcx.ccx, unit_ty); @@ -4588,8 +4588,8 @@ fn trans_lval(&@block_ctxt cx, &@ast::expr e) -> lval_result { auto sub = trans_expr(cx, base); auto val = sub.bcx.build.GEP(sub.val, - vec(C_int(0), - C_int(abi::box_rc_field_body))); + [C_int(0), + C_int(abi::box_rc_field_body)]); ret lval_mem(sub.bcx, val); } case (ast::expr_self_method(?ident, ?ann)) { @@ -4677,13 +4677,13 @@ fn trans_bind_thunk(&@local_ctxt cx, auto llclosure = bcx.build.PointerCast(fcx.llenv, llclosure_ptr_ty); auto lltarget = GEP_tup_like(bcx, closure_ty, llclosure, - vec(0, + [0, abi::box_rc_field_body, - abi::closure_elt_target)); + abi::closure_elt_target]); bcx = lltarget.bcx; auto lltargetclosure = bcx.build.GEP(lltarget.val, - vec(C_int(0), - C_int(abi::fn_field_box))); + [C_int(0), + C_int(abi::fn_field_box)]); lltargetclosure = bcx.build.Load(lltargetclosure); auto outgoing_ret_ty = ty::ty_fn_ret(cx.ccx.tcx, outgoing_fty); @@ -4694,23 +4694,23 @@ fn trans_bind_thunk(&@local_ctxt cx, llretptr = bcx.build.PointerCast(llretptr, T_typaram_ptr(cx.ccx.tn)); } - let vec[ValueRef] llargs = vec(llretptr, + let vec[ValueRef] llargs = [llretptr, fcx.lltaskptr, - lltargetclosure); + lltargetclosure]; // Copy in the type parameters. let uint i = 0u; while (i < ty_param_count) { auto lltyparam_ptr = GEP_tup_like(bcx, closure_ty, llclosure, - vec(0, + [0, abi::box_rc_field_body, abi::closure_elt_ty_params, - (i as int))); + (i as int)]); bcx = lltyparam_ptr.bcx; auto td = bcx.build.Load(lltyparam_ptr.val); - llargs += vec(td); - fcx.lltydescs += vec(td); + llargs += [td]; + fcx.lltydescs += [td]; i += 1u; } @@ -4732,10 +4732,10 @@ fn trans_bind_thunk(&@local_ctxt cx, auto e_ty = ty::expr_ty(cx.ccx.tcx, cx.ccx.node_types, e); auto bound_arg = GEP_tup_like(bcx, closure_ty, llclosure, - vec(0, + [0, abi::box_rc_field_body, abi::closure_elt_bindings, - b)); + b]); bcx = bound_arg.bcx; auto val = bound_arg.val; @@ -4754,7 +4754,7 @@ fn trans_bind_thunk(&@local_ctxt cx, val = bcx.build.PointerCast(val, llout_arg_ty); } - llargs += vec(val); + llargs += [val]; b += 1; } @@ -4768,7 +4768,7 @@ fn trans_bind_thunk(&@local_ctxt cx, llout_arg_ty); } - llargs += vec(passed_arg); + llargs += [passed_arg]; a += 1u; } } @@ -4778,8 +4778,8 @@ fn trans_bind_thunk(&@local_ctxt cx, // FIXME: turn this call + ret into a tail call. auto lltargetfn = bcx.build.GEP(lltarget.val, - vec(C_int(0), - C_int(abi::fn_field_code))); + [C_int(0), + C_int(abi::fn_field_code)]); // Cast the outgoing function to the appropriate type (see the comments in // trans_bind below for why this is necessary). @@ -4808,7 +4808,7 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f, if (f_res.is_mem) { cx.fcx.lcx.ccx.sess.unimpl("re-binding existing function"); } else { - let vec[@ast::expr] bound = vec(); + let vec[@ast::expr] bound = []; for (option::t[@ast::expr] argopt in args) { alt (argopt) { @@ -4827,7 +4827,7 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f, case (none[generic_info]) { outgoing_fty = ty::expr_ty(cx.fcx.lcx.ccx.tcx, cx.fcx.lcx.ccx.node_types, f); - lltydescs = vec(); + lltydescs = []; } case (some[generic_info](?ginfo)) { lazily_emit_all_generic_info_tydesc_glues(cx, ginfo); @@ -4846,8 +4846,8 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f, auto pair_v = alloca(bcx, pair_t); // Translate the bound expressions. - let vec[ty::t] bound_tys = vec(); - let vec[ValueRef] bound_vals = vec(); + let vec[ty::t] bound_tys = []; + let vec[ValueRef] bound_vals = []; auto i = 0u; for (@ast::expr e in bound) { auto arg = trans_expr(bcx, e); @@ -4874,10 +4874,10 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f, _vec::init_elt[ty::t](tydesc_ty, ty_param_count); let vec[ty::t] closure_tys = - vec(tydesc_ty, + [tydesc_ty, outgoing_fty, bindings_ty, - ty::mk_imm_tup(cx.fcx.lcx.ccx.tcx, captured_tys)); + ty::mk_imm_tup(cx.fcx.lcx.ccx.tcx, captured_tys)]; let ty::t closure_ty = ty::mk_imm_tup(cx.fcx.lcx.ccx.tcx, closure_tys); @@ -4886,19 +4886,19 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f, auto box = r.val; bcx = r.bcx; auto rc = bcx.build.GEP(box, - vec(C_int(0), - C_int(abi::box_rc_field_refcnt))); + [C_int(0), + C_int(abi::box_rc_field_refcnt)]); auto closure = bcx.build.GEP(box, - vec(C_int(0), - C_int(abi::box_rc_field_body))); + [C_int(0), + C_int(abi::box_rc_field_body)]); bcx.build.Store(C_int(1), rc); // Store bindings tydesc. auto bound_tydesc = bcx.build.GEP(closure, - vec(C_int(0), - C_int(abi::closure_elt_tydesc))); + [C_int(0), + C_int(abi::closure_elt_tydesc)]); auto ti = none[@tydesc_info]; auto bindings_tydesc = get_tydesc(bcx, bindings_ty, true, ti); lazily_emit_tydesc_glue(bcx, abi::tydesc_field_drop_glue, ti); @@ -4921,8 +4921,8 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f, // Store thunk-target. auto bound_target = bcx.build.GEP(closure, - vec(C_int(0), - C_int(abi::closure_elt_target))); + [C_int(0), + C_int(abi::closure_elt_target)]); auto src = bcx.build.Load(f_res.res.val); bound_target = bcx.build.PointerCast(bound_target, llclosurety); bcx.build.Store(src, bound_target); @@ -4931,11 +4931,11 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f, i = 0u; auto bindings = bcx.build.GEP(closure, - vec(C_int(0), - C_int(abi::closure_elt_bindings))); + [C_int(0), + C_int(abi::closure_elt_bindings)]); for (ValueRef v in bound_vals) { auto bound = bcx.build.GEP(bindings, - vec(C_int(0), C_int(i as int))); + [C_int(0), C_int(i as int)]); bcx = copy_ty(bcx, INIT, bound, v, bound_tys.(i)).bcx; i += 1u; } @@ -4949,13 +4949,13 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f, lazily_emit_all_generic_info_tydesc_glues(cx, ginfo); auto ty_params_slot = bcx.build.GEP(closure, - vec(C_int(0), - C_int(abi::closure_elt_ty_params))); + [C_int(0), + C_int(abi::closure_elt_ty_params)]); auto i = 0; for (ValueRef td in ginfo.tydescs) { auto ty_param_slot = bcx.build.GEP(ty_params_slot, - vec(C_int(0), - C_int(i))); + [C_int(0), + C_int(i)]); bcx.build.Store(td, ty_param_slot); i += 1; } @@ -4966,8 +4966,8 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f, // Make thunk and store thunk-ptr in outer pair's code slot. auto pair_code = bcx.build.GEP(pair_v, - vec(C_int(0), - C_int(abi::fn_field_code))); + [C_int(0), + C_int(abi::fn_field_code)]); let ty::t pair_ty = node_ann_type(cx.fcx.lcx.ccx, ann); @@ -4980,8 +4980,8 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f, // Store box ptr in outer pair's box slot. auto pair_box = bcx.build.GEP(pair_v, - vec(C_int(0), - C_int(abi::fn_field_box))); + [C_int(0), + C_int(abi::fn_field_box)]); bcx.build.Store (bcx.build.PointerCast (box, @@ -4989,7 +4989,7 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f, pair_box); find_scope_cx(cx).cleanups += - vec(clean(bind drop_slot(_, pair_v, pair_ty))); + [clean(bind drop_slot(_, pair_v, pair_ty))]; ret res(bcx, pair_v); } @@ -5079,8 +5079,8 @@ fn trans_args(&@block_ctxt cx, -> tup(@block_ctxt, vec[ValueRef], ValueRef) { let vec[ty::arg] args = ty::ty_fn_args(cx.fcx.lcx.ccx.tcx, fn_ty); - let vec[ValueRef] llargs = vec(); - let vec[ValueRef] lltydescs = vec(); + let vec[ValueRef] llargs = []; + let vec[ValueRef] lltydescs = []; let @block_ctxt bcx = cx; @@ -5101,8 +5101,8 @@ fn trans_args(&@block_ctxt cx, } } if (ty::type_has_dynamic_size(cx.fcx.lcx.ccx.tcx, retty)) { - llargs += vec(bcx.build.PointerCast - (llretslot, T_typaram_ptr(cx.fcx.lcx.ccx.tn))); + llargs += [bcx.build.PointerCast + (llretslot, T_typaram_ptr(cx.fcx.lcx.ccx.tn))]; } else if (ty::type_contains_params(cx.fcx.lcx.ccx.tcx, retty)) { // It's possible that the callee has some generic-ness somewhere in // its return value -- say a method signature within an obj or a fn @@ -5110,15 +5110,15 @@ fn trans_args(&@block_ctxt cx, // of. If so, cast the caller's view of the restlot to the callee's // view, for the sake of making a type-compatible call. llargs += - vec(cx.build.PointerCast(llretslot, - T_ptr(type_of(bcx.fcx.lcx.ccx, retty)))); + [cx.build.PointerCast(llretslot, + T_ptr(type_of(bcx.fcx.lcx.ccx, retty)))]; } else { - llargs += vec(llretslot); + llargs += [llretslot]; } // Arg 1: task pointer. - llargs += vec(bcx.fcx.lltaskptr); + llargs += [bcx.fcx.lltaskptr]; // Arg 2: Env (closure-bindings / self-obj) alt (llobj) { @@ -5126,10 +5126,10 @@ fn trans_args(&@block_ctxt cx, // Every object is always found in memory, // and not-yet-loaded (as part of an lval x.y // doted method-call). - llargs += vec(bcx.build.Load(ob)); + llargs += [bcx.build.Load(ob)]; } case (_) { - llargs += vec(llenv); + llargs += [llenv]; } } @@ -5140,7 +5140,7 @@ fn trans_args(&@block_ctxt cx, alt (lliterbody) { case (none[ValueRef]) {} case (some[ValueRef](?lli)) { - llargs += vec(lli); + llargs += [lli]; } } @@ -5155,7 +5155,7 @@ fn trans_args(&@block_ctxt cx, for (@ast::expr e in es) { auto r = trans_arg_expr(bcx, args.(i), arg_tys.(i), e); bcx = r.bcx; - llargs += vec(r.val); + llargs += [r.val]; i += 1u; } @@ -5184,13 +5184,13 @@ fn trans_call(&@block_ctxt cx, &@ast::expr f, // It's a closure. auto bcx = f_res.res.bcx; auto pair = faddr; - faddr = bcx.build.GEP(pair, vec(C_int(0), - C_int(abi::fn_field_code))); + faddr = bcx.build.GEP(pair, [C_int(0), + C_int(abi::fn_field_code)]); faddr = bcx.build.Load(faddr); auto llclosure = bcx.build.GEP(pair, - vec(C_int(0), - C_int(abi::fn_field_box))); + [C_int(0), + C_int(abi::fn_field_box)]); llenv = bcx.build.Load(llclosure); } } @@ -5239,7 +5239,7 @@ fn trans_call(&@block_ctxt cx, &@ast::expr f, // the frame, but it's a ref all the same, so we put a note // here to drop it when we're done in this scope. find_scope_cx(cx).cleanups += - vec(clean(bind drop_ty(_, retval, ret_ty))); + [clean(bind drop_ty(_, retval, ret_ty))]; } } case (some[ValueRef](_)) { @@ -5260,7 +5260,7 @@ fn trans_tup(&@block_ctxt cx, &vec[ast::elt] elts, bcx = tup_res.bcx; find_scope_cx(cx).cleanups += - vec(clean(bind drop_ty(_, tup_val, t))); + [clean(bind drop_ty(_, tup_val, t))]; let int i = 0; for (ast::elt e in elts) { @@ -5268,7 +5268,7 @@ fn trans_tup(&@block_ctxt cx, &vec[ast::elt] elts, e.expr); auto src_res = trans_expr(bcx, e.expr); bcx = src_res.bcx; - auto dst_res = GEP_tup_like(bcx, t, tup_val, vec(0, i)); + auto dst_res = GEP_tup_like(bcx, t, tup_val, [0, i]); bcx = dst_res.bcx; bcx = copy_ty(src_res.bcx, INIT, dst_res.val, src_res.val, e_ty).bcx; i += 1; @@ -5297,16 +5297,16 @@ fn trans_vec(&@block_ctxt cx, &vec[@ast::expr] args, // FIXME: pass tydesc properly. auto vec_val = bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.new_vec, - vec(bcx.fcx.lltaskptr, data_sz, - C_null(T_ptr(T_tydesc(bcx.fcx.lcx.ccx.tn))))); + [bcx.fcx.lltaskptr, data_sz, + C_null(T_ptr(T_tydesc(bcx.fcx.lcx.ccx.tn)))]); auto llty = type_of(bcx.fcx.lcx.ccx, t); vec_val = bcx.build.PointerCast(vec_val, llty); find_scope_cx(bcx).cleanups += - vec(clean(bind drop_ty(_, vec_val, t))); + [clean(bind drop_ty(_, vec_val, t))]; - auto body = bcx.build.GEP(vec_val, vec(C_int(0), - C_int(abi::vec_elt_data))); + auto body = bcx.build.GEP(vec_val, [C_int(0), + C_int(abi::vec_elt_data)]); auto pseudo_tup_ty = ty::mk_imm_tup(cx.fcx.lcx.ccx.tcx, @@ -5317,7 +5317,7 @@ fn trans_vec(&@block_ctxt cx, &vec[@ast::expr] args, for (@ast::expr e in args) { auto src_res = trans_expr(bcx, e); bcx = src_res.bcx; - auto dst_res = GEP_tup_like(bcx, pseudo_tup_ty, body, vec(0, i)); + auto dst_res = GEP_tup_like(bcx, pseudo_tup_ty, body, [0, i]); bcx = dst_res.bcx; // Cast the destination type to the source type. This is needed to @@ -5344,7 +5344,7 @@ fn trans_vec(&@block_ctxt cx, &vec[@ast::expr] args, i += 1; } auto fill = bcx.build.GEP(vec_val, - vec(C_int(0), C_int(abi::vec_elt_fill))); + [C_int(0), C_int(abi::vec_elt_fill)]); bcx.build.Store(data_sz, fill); ret res(bcx, vec_val); @@ -5360,7 +5360,7 @@ fn trans_rec(&@block_ctxt cx, &vec[ast::field] fields, bcx = rec_res.bcx; find_scope_cx(cx).cleanups += - vec(clean(bind drop_ty(_, rec_val, t))); + [clean(bind drop_ty(_, rec_val, t))]; let int i = 0; auto base_val = C_nil(); @@ -5374,14 +5374,14 @@ fn trans_rec(&@block_ctxt cx, &vec[ast::field] fields, } } - let vec[ty::field] ty_fields = vec(); + let vec[ty::field] ty_fields = []; alt (ty::struct(cx.fcx.lcx.ccx.tcx, t)) { case (ty::ty_rec(?flds)) { ty_fields = flds; } } for (ty::field tf in ty_fields) { auto e_ty = tf.mt.ty; - auto dst_res = GEP_tup_like(bcx, t, rec_val, vec(0, i)); + auto dst_res = GEP_tup_like(bcx, t, rec_val, [0, i]); bcx = dst_res.bcx; auto expr_provided = false; @@ -5394,7 +5394,7 @@ fn trans_rec(&@block_ctxt cx, &vec[ast::field] fields, } } if (!expr_provided) { - src_res = GEP_tup_like(bcx, t, base_val, vec(0, i)); + src_res = GEP_tup_like(bcx, t, base_val, [0, i]); src_res = res(src_res.bcx, load_if_immediate(bcx, src_res.val, e_ty)); } @@ -5662,29 +5662,29 @@ fn trans_log(int lvl, &@block_ctxt cx, &@ast::expr e) -> result { } if (is32bit) { log_bcx.build.Call(log_bcx.fcx.lcx.ccx.upcalls.log_float, - vec(log_bcx.fcx.lltaskptr, C_int(lvl), - sub.val)); + [log_bcx.fcx.lltaskptr, C_int(lvl), + sub.val]); } else { // FIXME: Eliminate this level of indirection. auto tmp = alloca(log_bcx, tr); sub.bcx.build.Store(sub.val, tmp); log_bcx.build.Call(log_bcx.fcx.lcx.ccx.upcalls.log_double, - vec(log_bcx.fcx.lltaskptr, C_int(lvl), tmp)); + [log_bcx.fcx.lltaskptr, C_int(lvl), tmp]); } } else { alt (ty::struct(cx.fcx.lcx.ccx.tcx, e_ty)) { case (ty::ty_str) { log_bcx.build.Call(log_bcx.fcx.lcx.ccx.upcalls.log_str, - vec(log_bcx.fcx.lltaskptr, C_int(lvl), - sub.val)); + [log_bcx.fcx.lltaskptr, C_int(lvl), + sub.val]); } case (_) { // FIXME: Handle signedness properly. auto llintval = int_cast(log_bcx, T_int(), val_ty(sub.val), sub.val, false); log_bcx.build.Call(log_bcx.fcx.lcx.ccx.upcalls.log_int, - vec(log_bcx.fcx.lltaskptr, C_int(lvl), - llintval)); + [log_bcx.fcx.lltaskptr, C_int(lvl), + llintval]); } } } @@ -5729,7 +5729,7 @@ fn trans_fail(&@block_ctxt cx, &option::t[common::span] sp_opt, &str fail_str) V_fail_str = cx.build.PointerCast(V_fail_str, T_ptr(T_i8())); V_filename = cx.build.PointerCast(V_filename, T_ptr(T_i8())); - auto args = vec(cx.fcx.lltaskptr, V_fail_str, V_filename, C_int(V_line)); + auto args = [cx.fcx.lltaskptr, V_fail_str, V_filename, C_int(V_line)]; cx.build.Call(cx.fcx.lcx.ccx.upcalls._fail, args); cx.build.Unreachable(); @@ -5745,28 +5745,28 @@ fn trans_put(&@block_ctxt cx, &option::t[@ast::expr] e) -> result { auto slot = alloca(cx, val_ty(lli)); cx.build.Store(lli, slot); - llcallee = cx.build.GEP(slot, vec(C_int(0), - C_int(abi::fn_field_code))); + llcallee = cx.build.GEP(slot, [C_int(0), + C_int(abi::fn_field_code)]); llcallee = cx.build.Load(llcallee); - llenv = cx.build.GEP(slot, vec(C_int(0), - C_int(abi::fn_field_box))); + llenv = cx.build.GEP(slot, [C_int(0), + C_int(abi::fn_field_box)]); llenv = cx.build.Load(llenv); } } auto bcx = cx; auto dummy_retslot = alloca(bcx, T_nil()); - let vec[ValueRef] llargs = vec(dummy_retslot, cx.fcx.lltaskptr, llenv); + let vec[ValueRef] llargs = [dummy_retslot, cx.fcx.lltaskptr, llenv]; alt (e) { case (none[@ast::expr]) { } case (some[@ast::expr](?x)) { auto e_ty = ty::expr_ty(cx.fcx.lcx.ccx.tcx, cx.fcx.lcx.ccx.node_types, x); auto arg = rec(mode=ty::mo_alias, ty=e_ty); - auto arg_tys = type_of_explicit_args(cx.fcx.lcx.ccx, vec(arg)); + auto arg_tys = type_of_explicit_args(cx.fcx.lcx.ccx, [arg]); auto r = trans_arg_expr(bcx, arg, arg_tys.(0), x); bcx = r.bcx; - llargs += vec(r.val); + llargs += [r.val]; } } @@ -5882,11 +5882,11 @@ fn trans_port(&@block_ctxt cx, &ast::ann ann) -> result { auto unit_sz = size_of(bcx, unit_ty); bcx = unit_sz.bcx; auto port_raw_val = bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.new_port, - vec(bcx.fcx.lltaskptr, unit_sz.val)); + [bcx.fcx.lltaskptr, unit_sz.val]); auto llty = type_of(cx.fcx.lcx.ccx, t); auto port_val = bcx.build.PointerCast(port_raw_val, llty); auto dropref = clean(bind drop_ty(_, port_val, t)); - find_scope_cx(bcx).cleanups += vec(dropref); + find_scope_cx(bcx).cleanups += [dropref]; ret res(bcx, port_val); } @@ -5899,13 +5899,13 @@ fn trans_chan(&@block_ctxt cx, &@ast::expr e, &ast::ann ann) -> result { auto prt_val = bcx.build.PointerCast(prt.val, T_opaque_port_ptr()); auto chan_raw_val = bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.new_chan, - vec(bcx.fcx.lltaskptr, prt_val)); + [bcx.fcx.lltaskptr, prt_val]); auto chan_ty = node_ann_type(bcx.fcx.lcx.ccx, ann); auto chan_llty = type_of(bcx.fcx.lcx.ccx, chan_ty); auto chan_val = bcx.build.PointerCast(chan_raw_val, chan_llty); auto dropref = clean(bind drop_ty(_, chan_val, chan_ty)); - find_scope_cx(bcx).cleanups += vec(dropref); + find_scope_cx(bcx).cleanups += [dropref]; ret res(bcx, chan_val); } @@ -5937,12 +5937,12 @@ fn trans_send(&@block_ctxt cx, &@ast::expr lhs, &@ast::expr rhs, bcx = data_tmp.bcx; find_scope_cx(bcx).cleanups += - vec(clean(bind drop_ty(_, data_alloc.val, unit_ty))); + [clean(bind drop_ty(_, data_alloc.val, unit_ty))]; auto llchanval = bcx.build.PointerCast(chn.val, T_opaque_chan_ptr()); auto lldataptr = bcx.build.PointerCast(data_alloc.val, T_ptr(T_i8())); bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.send, - vec(bcx.fcx.lltaskptr, llchanval, lldataptr)); + [bcx.fcx.lltaskptr, llchanval, lldataptr]); ret res(bcx, chn.val); } @@ -5970,7 +5970,7 @@ fn recv_val(&@block_ctxt cx, ValueRef lhs, &@ast::expr rhs, auto lldataptr = bcx.build.PointerCast(lhs, T_ptr(T_ptr(T_i8()))); auto llportptr = bcx.build.PointerCast(prt.val, T_opaque_port_ptr()); bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.recv, - vec(bcx.fcx.lltaskptr, lldataptr, llportptr)); + [bcx.fcx.lltaskptr, lldataptr, llportptr]); auto data_load = load_if_immediate(bcx, lhs, unit_ty); auto cp = copy_ty(bcx, action, lhs, data_load, unit_ty); @@ -5990,7 +5990,7 @@ fn init_local(&@block_ctxt cx, &@ast::local local) -> result { auto bcx = cx; find_scope_cx(cx).cleanups += - vec(clean(bind drop_slot(_, llptr, ty))); + [clean(bind drop_slot(_, llptr, ty))]; alt (local.init) { case (some[ast::initializer](?init)) { @@ -6061,7 +6061,7 @@ fn new_builder(BasicBlockRef llbb) -> builder { fn new_block_ctxt(&@fn_ctxt cx, &block_parent parent, block_kind kind, &str name) -> @block_ctxt { - let vec[cleanup] cleanups = vec(); + let vec[cleanup] cleanups = []; auto s = _str::buf(""); if (cx.lcx.ccx.sess.get_opts().save_temps) { s = _str::buf(cx.lcx.ccx.names.next(name)); @@ -6098,7 +6098,7 @@ fn new_sub_block_ctxt(&@block_ctxt bcx, &str n) -> @block_ctxt { } fn new_raw_block_ctxt(&@fn_ctxt fcx, BasicBlockRef llbb) -> @block_ctxt { - let vec[cleanup] cleanups = vec(); + let vec[cleanup] cleanups = []; ret @rec(llbb=llbb, build=new_builder(llbb), parent=parent_none, kind=NON_SCOPE_BLOCK, mutable cleanups=cleanups, fcx=fcx); } @@ -6144,7 +6144,7 @@ iter block_locals(&ast::block b) -> @ast::local { } fn llallocas_block_ctxt(&@fn_ctxt fcx) -> @block_ctxt { - let vec[cleanup] cleanups = vec(); + let vec[cleanup] cleanups = []; ret @rec(llbb=fcx.llallocas, build=new_builder(fcx.llallocas), parent=parent_none, @@ -6246,7 +6246,7 @@ fn trans_block(&@block_ctxt cx, &ast::block b) -> result { auto cleanup = bind drop_hoisted_ty(_, res_alloca.val, r_ty); - find_outer_scope_cx(bcx).cleanups += vec(clean(cleanup)); + find_outer_scope_cx(bcx).cleanups += [clean(cleanup)]; } } } @@ -6260,11 +6260,11 @@ fn trans_block(&@block_ctxt cx, &ast::block b) -> result { } fn new_local_ctxt(&@crate_ctxt ccx) -> @local_ctxt { - let vec[str] pth = vec(); - let vec[ast::ty_param] obj_typarams = vec(); - let vec[ast::obj_field] obj_fields = vec(); + let vec[str] pth = []; + let vec[ast::ty_param] obj_typarams = []; + let vec[ast::obj_field] obj_fields = []; ret @rec(path=pth, - module_path=vec(crate_name(ccx, "main")), + module_path=[crate_name(ccx, "main")], obj_typarams = obj_typarams, obj_fields = obj_fields, ccx = ccx); @@ -6346,7 +6346,7 @@ fn create_llargs_for_fn_args(&@fn_ctxt cx, for (ast::ty_param tp in ty_params) { auto llarg = llvm::LLVMGetParam(cx.llfn, arg_n); assert (llarg as int != 0); - cx.lltydescs += vec(llarg); + cx.lltydescs += [llarg]; arg_n += 1u; i += 1u; } @@ -6422,7 +6422,7 @@ fn add_cleanups_for_args(&@block_ctxt bcx, if (aarg.mode != ast::alias) { auto argval = bcx.fcx.llargs.get(aarg.id); find_scope_cx(bcx).cleanups += - vec(clean(bind drop_slot(_, argval, arg_tys.(arg_n).ty))); + [clean(bind drop_slot(_, argval, arg_tys.(arg_n).ty))]; } arg_n += 1u; } @@ -6460,10 +6460,10 @@ fn ret_ty_of_fn(&@crate_ctxt ccx, ast::ann ann) -> ty::t { fn populate_fn_ctxt_from_llself(@fn_ctxt fcx, self_vt llself) { auto bcx = llallocas_block_ctxt(fcx); - let vec[ty::t] field_tys = vec(); + let vec[ty::t] field_tys = []; for (ast::obj_field f in bcx.fcx.lcx.obj_fields) { - field_tys += vec(node_ann_type(bcx.fcx.lcx.ccx, f.ann)); + field_tys += [node_ann_type(bcx.fcx.lcx.ccx, f.ann)]; } // Synthesize a tuple type for the fields so that GEP_tup_like() can work @@ -6475,17 +6475,17 @@ fn populate_fn_ctxt_from_llself(@fn_ctxt fcx, self_vt llself) { auto box_cell = bcx.build.GEP(llself.v, - vec(C_int(0), - C_int(abi::obj_field_box))); + [C_int(0), + C_int(abi::obj_field_box)]); auto box_ptr = bcx.build.Load(box_cell); box_ptr = bcx.build.PointerCast(box_ptr, llobj_box_ty); auto obj_typarams = bcx.build.GEP(box_ptr, - vec(C_int(0), + [C_int(0), C_int(abi::box_rc_field_body), - C_int(abi::obj_body_elt_typarams))); + C_int(abi::obj_body_elt_typarams)]); // The object fields immediately follow the type parameters, so we skip // over them to get the pointer. @@ -6507,16 +6507,16 @@ fn populate_fn_ctxt_from_llself(@fn_ctxt fcx, self_vt llself) { for (ast::ty_param p in fcx.lcx.obj_typarams) { let ValueRef lltyparam = bcx.build.GEP(obj_typarams, - vec(C_int(0), - C_int(i))); + [C_int(0), + C_int(i)]); lltyparam = bcx.build.Load(lltyparam); - fcx.lltydescs += vec(lltyparam); + fcx.lltydescs += [lltyparam]; i += 1; } i = 0; for (ast::obj_field f in fcx.lcx.obj_fields) { - auto rslt = GEP_tup_like(bcx, fields_tup_ty, obj_fields, vec(0, i)); + auto rslt = GEP_tup_like(bcx, fields_tup_ty, obj_fields, [0, i]); bcx = llallocas_block_ctxt(fcx); auto llfield = rslt.val; fcx.llobjfields.insert(f.id, llfield); @@ -6584,7 +6584,7 @@ fn trans_vtbl(@local_ctxt cx, } case (none[@ast::method]) {} } - let vec[ValueRef] methods = vec(dtor); + let vec[ValueRef] methods = [dtor]; fn meth_lteq(&@ast::method a, &@ast::method b) -> bool { ret _str::lteq(a.node.ident, b.node.ident); @@ -6615,7 +6615,7 @@ fn trans_vtbl(@local_ctxt cx, trans_fn(mcx, m.node.meth, m.node.id, some[tup(TypeRef, ty::t)](tup(llself_ty, self_ty)), ty_params, m.node.ann); - methods += vec(llfn); + methods += [llfn]; } auto vtbl = C_struct(methods); auto vtbl_name = mangle_name_by_seq(cx.ccx, cx.path, "vtbl"); @@ -6654,9 +6654,9 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid, auto llctor_decl = ccx.item_ids.get(oid); // Translate obj ctor args to function arguments. - let vec[ast::arg] fn_args = vec(); + let vec[ast::arg] fn_args = []; for (ast::obj_field f in ob.fields) { - fn_args += vec(rec(mode=ast::alias, ty=f.ty, ident=f.ident, id=f.id)); + fn_args += [rec(mode=ast::alias, ty=f.ty, ident=f.ident, id=f.id)]; } auto fcx = new_fn_ctxt(cx, llctor_decl); @@ -6677,11 +6677,11 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid, auto vtbl = trans_vtbl(cx, llself_ty, self_ty, ob, ty_params); auto pair_vtbl = bcx.build.GEP(pair, - vec(C_int(0), - C_int(abi::obj_field_vtbl))); + [C_int(0), + C_int(abi::obj_field_vtbl)]); auto pair_box = bcx.build.GEP(pair, - vec(C_int(0), - C_int(abi::obj_field_box))); + [C_int(0), + C_int(abi::obj_field_box)]); bcx.build.Store(vtbl, pair_vtbl); let TypeRef llbox_ty = T_opaque_obj_ptr(ccx.tn); @@ -6694,14 +6694,14 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid, bcx.build.Store(C_null(llbox_ty), pair_box); } else { // Malloc a box for the body and copy args in. - let vec[ty::t] obj_fields = vec(); + let vec[ty::t] obj_fields = []; for (ty::arg a in arg_tys) { _vec::push[ty::t](obj_fields, a.ty); } // Synthesize an obj body type. auto tydesc_ty = ty::mk_type(ccx.tcx); - let vec[ty::t] tps = vec(); + let vec[ty::t] tps = []; for (ast::ty_param tp in ty_params) { _vec::push[ty::t](tps, tydesc_ty); } @@ -6709,26 +6709,26 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid, let ty::t typarams_ty = ty::mk_imm_tup(ccx.tcx, tps); let ty::t fields_ty = ty::mk_imm_tup(ccx.tcx, obj_fields); let ty::t body_ty = ty::mk_imm_tup(ccx.tcx, - vec(tydesc_ty, + [tydesc_ty, typarams_ty, - fields_ty)); + fields_ty]); let ty::t boxed_body_ty = ty::mk_imm_box(ccx.tcx, body_ty); // Malloc a box for the body. auto box = trans_malloc_boxed(bcx, body_ty); bcx = box.bcx; auto rc = GEP_tup_like(bcx, boxed_body_ty, box.val, - vec(0, abi::box_rc_field_refcnt)); + [0, abi::box_rc_field_refcnt]); bcx = rc.bcx; auto body = GEP_tup_like(bcx, boxed_body_ty, box.val, - vec(0, abi::box_rc_field_body)); + [0, abi::box_rc_field_body]); bcx = body.bcx; bcx.build.Store(C_int(1), rc.val); // Store body tydesc. auto body_tydesc = GEP_tup_like(bcx, body_ty, body.val, - vec(0, abi::obj_body_elt_tydesc)); + [0, abi::obj_body_elt_tydesc]); bcx = body_tydesc.bcx; auto ti = none[@tydesc_info]; @@ -6749,13 +6749,13 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid, // Copy typarams into captured typarams. auto body_typarams = GEP_tup_like(bcx, body_ty, body.val, - vec(0, abi::obj_body_elt_typarams)); + [0, abi::obj_body_elt_typarams]); bcx = body_typarams.bcx; let int i = 0; for (ast::ty_param tp in ty_params) { auto typaram = bcx.fcx.lltydescs.(i); auto capture = GEP_tup_like(bcx, typarams_ty, body_typarams.val, - vec(0, i)); + [0, i]); bcx = capture.bcx; bcx = copy_ty(bcx, INIT, capture.val, typaram, tydesc_ty).bcx; i += 1; @@ -6764,7 +6764,7 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid, // Copy args into body fields. auto body_fields = GEP_tup_like(bcx, body_ty, body.val, - vec(0, abi::obj_body_elt_fields)); + [0, abi::obj_body_elt_fields]); bcx = body_fields.bcx; i = 0; @@ -6772,7 +6772,7 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid, auto arg = bcx.fcx.llargs.get(f.id); arg = load_if_immediate(bcx, arg, arg_tys.(i).ty); auto field = GEP_tup_like(bcx, fields_ty, body_fields.val, - vec(0, i)); + [0, i]); bcx = field.bcx; bcx = copy_ty(bcx, INIT, field.val, arg, arg_tys.(i).ty).bcx; i += 1; @@ -6794,13 +6794,13 @@ fn trans_tag_variant(@local_ctxt cx, ast::def_id tag_id, } // Translate variant arguments to function arguments. - let vec[ast::arg] fn_args = vec(); + let vec[ast::arg] fn_args = []; auto i = 0u; for (ast::variant_arg varg in variant.node.args) { - fn_args += vec(rec(mode=ast::alias, + fn_args += [rec(mode=ast::alias, ty=varg.ty, ident="arg" + _uint::to_str(i, 10u), - id=varg.id)); + id=varg.id)]; } assert (cx.ccx.item_ids.contains_key(variant.node.id)); @@ -6813,10 +6813,10 @@ fn trans_tag_variant(@local_ctxt cx, ast::def_id tag_id, ret_ty_of_fn(cx.ccx, variant.node.ann), fn_args, ty_params); - let vec[ty::t] ty_param_substs = vec(); + let vec[ty::t] ty_param_substs = []; i = 0u; for (ast::ty_param tp in ty_params) { - ty_param_substs += vec(ty::mk_param(cx.ccx.tcx, i)); + ty_param_substs += [ty::mk_param(cx.ccx.tcx, i)]; i += 1u; } @@ -6831,11 +6831,11 @@ fn trans_tag_variant(@local_ctxt cx, ast::def_id tag_id, T_opaque_tag_ptr(fcx.lcx.ccx.tn)); auto lldiscrimptr = bcx.build.GEP(lltagptr, - vec(C_int(0), C_int(0))); + [C_int(0), C_int(0)]); bcx.build.Store(C_int(index), lldiscrimptr); auto llblobptr = bcx.build.GEP(lltagptr, - vec(C_int(0), C_int(1))); + [C_int(0), C_int(1)]); i = 0u; for (ast::variant_arg va in variant.node.args) { @@ -6911,8 +6911,8 @@ fn trans_item(@local_ctxt cx, &ast::item item) { trans_obj(sub_cx, ob, oid.ctor, tps, ann); } case (ast::item_mod(?name, ?m, _)) { - auto sub_cx = @rec(path = cx.path + vec(name), - module_path = cx.module_path + vec(name) + auto sub_cx = @rec(path = cx.path + [name], + module_path = cx.module_path + [name] with *cx); trans_mod(sub_cx, m); } @@ -6939,7 +6939,7 @@ fn trans_mod(@local_ctxt cx, &ast::_mod m) { fn get_pair_fn_ty(TypeRef llpairty) -> TypeRef { // Bit of a kludge: pick the fn typeref out of the pair. - let vec[TypeRef] pair_tys = vec(T_nil(), T_nil()); + let vec[TypeRef] pair_tys = [T_nil(), T_nil()]; llvm::LLVMGetStructElementTypes(llpairty, _vec::buf[TypeRef](pair_tys)); ret llvm::LLVMGetElementType(pair_tys.(0)); @@ -6980,8 +6980,8 @@ fn register_fn_pair(&@crate_ctxt cx, str ps, TypeRef llpairty, ValueRef llfn, ast::def_id id) { let ValueRef gvar = llvm::LLVMAddGlobal(cx.llmod, llpairty, _str::buf(ps)); - auto pair = C_struct(vec(llfn, - C_null(T_opaque_closure_ptr(cx.tn)))); + auto pair = C_struct([llfn, + C_null(T_opaque_closure_ptr(cx.tn))]); llvm::LLVMSetInitializer(gvar, pair); llvm::LLVMSetGlobalConstant(gvar, True); @@ -7089,19 +7089,19 @@ fn decl_native_fn_and_pair(&@crate_ctxt ccx, lltaskptr = fcx.lltaskptr; } - let vec[ValueRef] call_args = vec(); - if (pass_task) { call_args += vec(lltaskptr); } + let vec[ValueRef] call_args = []; + if (pass_task) { call_args += [lltaskptr]; } auto arg_n = 3u; for each (uint i in _uint::range(0u, num_ty_param)) { auto llarg = llvm::LLVMGetParam(fcx.llfn, arg_n); - fcx.lltydescs += vec(llarg); + fcx.lltydescs += [llarg]; assert (llarg as int != 0); if (cast_to_i32) { - call_args += vec(vp2i(bcx, llarg)); + call_args += [vp2i(bcx, llarg)]; } else { - call_args += vec(llarg); + call_args += [llarg]; } arg_n += 1u; @@ -7134,9 +7134,9 @@ fn decl_native_fn_and_pair(&@crate_ctxt ccx, &mutable vec[ValueRef] call_args, ty::t fn_type, uint first_arg_n) -> tup(ValueRef, ValueRef) { - let vec[TypeRef] call_arg_tys = vec(); + let vec[TypeRef] call_arg_tys = []; for (ValueRef arg in call_args) { - call_arg_tys += vec(val_ty(arg)); + call_arg_tys += [val_ty(arg)]; } auto llnativefnty = @@ -7158,7 +7158,7 @@ fn decl_native_fn_and_pair(&@crate_ctxt ccx, auto args = ty::ty_fn_args(ccx.tcx, fn_type); // Build up the list of arguments. - let vec[tup(ValueRef, ty::t)] drop_args = vec(); + let vec[tup(ValueRef, ty::t)] drop_args = []; auto i = arg_n; for (ty::arg arg in args) { auto llarg = llvm::LLVMGetParam(fcx.llfn, i); @@ -7166,13 +7166,13 @@ fn decl_native_fn_and_pair(&@crate_ctxt ccx, if (cast_to_i32) { auto llarg_i32 = convert_arg_to_i32(bcx, llarg, arg.ty, arg.mode); - call_args += vec(llarg_i32); + call_args += [llarg_i32]; } else { - call_args += vec(llarg); + call_args += [llarg]; } if (arg.mode == ty::mo_val) { - drop_args += vec(tup(llarg, arg.ty)); + drop_args += [tup(llarg, arg.ty)]; } i += 1u; @@ -7217,7 +7217,7 @@ fn decl_native_fn_and_pair(&@crate_ctxt ccx, type walk_ctxt = rec(mutable vec[str] path); fn new_walk_ctxt() -> @walk_ctxt { - let vec[str] path = vec(); + let vec[str] path = []; ret @rec(mutable path=path); } @@ -7338,7 +7338,7 @@ fn collect_tag_ctor(&@crate_ctxt ccx, @walk_ctxt wcx, &@ast::item i) { case (ast::item_tag(_, ?variants, ?tps, _, _)) { for (ast::variant variant in variants) { if (_vec::len[ast::variant_arg](variant.node.args) != 0u) { - decl_fn_and_pair(ccx, wcx.path + vec(variant.node.name), + decl_fn_and_pair(ccx, wcx.path + [variant.node.name], "tag", tps, variant.node.ann, variant.node.id); } @@ -7392,7 +7392,7 @@ fn trans_constant(&@crate_ctxt ccx, @walk_ctxt wcx, &@ast::item it) { // with consts. auto v = C_int(1); ccx.item_ids.insert(cid, v); - auto s = mangle_name_by_type(ccx, wcx.path + vec(name), + auto s = mangle_name_by_type(ccx, wcx.path + [name], node_ann_type(ccx, ann)); ccx.item_symbols.insert(cid, s); } @@ -7430,8 +7430,8 @@ fn i2p(ValueRef v, TypeRef t) -> ValueRef { fn trans_exit_task_glue(@glue_fns glues, &hashmap[str, ValueRef] externs, type_names tn, ModuleRef llmod) { - let vec[TypeRef] T_args = vec(); - let vec[ValueRef] V_args = vec(); + let vec[TypeRef] T_args = []; + let vec[ValueRef] V_args = []; auto llfn = glues.exit_task_glue; @@ -7444,14 +7444,14 @@ fn trans_exit_task_glue(@glue_fns glues, let ValueRef arg4 = llvm::LLVMGetParam(llfn, 3u); let ValueRef arg5 = llvm::LLVMGetParam(llfn, 4u); - auto main_type = T_fn(vec(T_int(), T_int(), T_int(), T_int()), T_void()); + auto main_type = T_fn([T_int(), T_int(), T_int(), T_int()], T_void()); auto fun = build.IntToPtr(arg1, T_ptr(main_type)); - auto call_args = vec(arg2, arg3, arg4, arg5); + auto call_args = [arg2, arg3, arg4, arg5]; build.FastCall(fun, call_args); trans_native_call(build, glues, arg3, - externs, tn, llmod, "upcall_exit", true, vec(arg3)); + externs, tn, llmod, "upcall_exit", true, [arg3]); build.RetVoid(); } @@ -7476,7 +7476,7 @@ fn create_crate_constant(ValueRef crate_ptr, @glue_fns glues) { llvm::LLVMConstSub(p2i(glues.exit_task_glue), crate_addr); let ValueRef crate_val = - C_struct(vec(C_null(T_int()), // ptrdiff_t image_base_off + C_struct([C_null(T_int()), // ptrdiff_t image_base_off p2i(crate_ptr), // uintptr_t self_addr C_null(T_int()), // ptrdiff_t debug_abbrev_off C_null(T_int()), // size_t debug_abbrev_sz @@ -7491,7 +7491,7 @@ fn create_crate_constant(ValueRef crate_ptr, @glue_fns glues) { C_null(T_int()), // int n_c_syms C_null(T_int()), // int n_libs C_int(abi::abi_x86_rustc_fastcall) // uintptr_t abi_tag - )); + ]); llvm::LLVMSetInitializer(crate_ptr, crate_val); } @@ -7521,8 +7521,8 @@ fn find_main_fn(&@crate_ctxt cx) -> ValueRef { } fn trans_main_fn(@local_ctxt cx, ValueRef llcrate, ValueRef crate_map) { - auto T_main_args = vec(T_int(), T_int()); - auto T_rust_start_args = vec(T_int(), T_int(), T_int(), T_int(), T_int()); + auto T_main_args = [T_int(), T_int()]; + auto T_rust_start_args = [T_int(), T_int(), T_int(), T_int(), T_int()]; auto main_name; if (_str::eq(std::os::target_os(), "win32")) { @@ -7553,25 +7553,25 @@ fn trans_main_fn(@local_ctxt cx, ValueRef llcrate, ValueRef crate_map) { llvm::LLVMAppendBasicBlock(llmain, _str::buf("")); auto b = new_builder(llbb); - auto start_args = vec(p2i(llrust_main), p2i(llcrate), llargc, llargv, - p2i(crate_map)); + auto start_args = [p2i(llrust_main), p2i(llcrate), llargc, llargv, + p2i(crate_map)]; b.Ret(b.Call(llrust_start, start_args)); } fn declare_intrinsics(ModuleRef llmod) -> hashmap[str,ValueRef] { - let vec[TypeRef] T_memmove32_args = vec(T_ptr(T_i8()), T_ptr(T_i8()), - T_i32(), T_i32(), T_i1()); - let vec[TypeRef] T_memmove64_args = vec(T_ptr(T_i8()), T_ptr(T_i8()), - T_i64(), T_i32(), T_i1()); + let vec[TypeRef] T_memmove32_args = [T_ptr(T_i8()), T_ptr(T_i8()), + T_i32(), T_i32(), T_i1()]; + let vec[TypeRef] T_memmove64_args = [T_ptr(T_i8()), T_ptr(T_i8()), + T_i64(), T_i32(), T_i1()]; - let vec[TypeRef] T_memset32_args = vec(T_ptr(T_i8()), T_i8(), - T_i32(), T_i32(), T_i1()); - let vec[TypeRef] T_memset64_args = vec(T_ptr(T_i8()), T_i8(), - T_i64(), T_i32(), T_i1()); + let vec[TypeRef] T_memset32_args = [T_ptr(T_i8()), T_i8(), + T_i32(), T_i32(), T_i1()]; + let vec[TypeRef] T_memset64_args = [T_ptr(T_i8()), T_i8(), + T_i64(), T_i32(), T_i1()]; - let vec[TypeRef] T_trap_args = vec(); + let vec[TypeRef] T_trap_args = []; auto memmove32 = decl_cdecl_fn(llmod, "llvm.memmove.p0i8.p0i8.i32", T_fn(T_memmove32_args, T_void())); @@ -7598,12 +7598,12 @@ fn declare_intrinsics(ModuleRef llmod) -> hashmap[str,ValueRef] { fn trace_str(&@block_ctxt cx, str s) { cx.build.Call(cx.fcx.lcx.ccx.upcalls.trace_str, - vec(cx.fcx.lltaskptr, C_cstr(cx.fcx.lcx.ccx, s))); + [cx.fcx.lltaskptr, C_cstr(cx.fcx.lcx.ccx, s)]); } fn trace_word(&@block_ctxt cx, ValueRef v) { cx.build.Call(cx.fcx.lcx.ccx.upcalls.trace_word, - vec(cx.fcx.lltaskptr, v)); + [cx.fcx.lltaskptr, v]); } fn trace_ptr(&@block_ctxt cx, ValueRef v) { @@ -7611,12 +7611,12 @@ fn trace_ptr(&@block_ctxt cx, ValueRef v) { } fn trap(&@block_ctxt bcx) { - let vec[ValueRef] v = vec(); + let vec[ValueRef] v = []; bcx.build.Call(bcx.fcx.lcx.ccx.intrinsics.get("llvm.trap"), v); } fn decl_no_op_type_glue(ModuleRef llmod, type_names tn) -> ValueRef { - auto ty = T_fn(vec(T_taskptr(tn), T_ptr(T_i8())), T_void()); + auto ty = T_fn([T_taskptr(tn), T_ptr(T_i8())], T_void()); ret decl_fastcall_fn(llmod, abi::no_op_type_glue_name(), ty); } @@ -7647,11 +7647,11 @@ fn make_vec_append_glue(ModuleRef llmod, type_names tn) -> ValueRef { * */ - auto ty = T_fn(vec(T_taskptr(tn), + auto ty = T_fn([T_taskptr(tn), T_ptr(T_tydesc(tn)), T_ptr(T_tydesc(tn)), T_ptr(T_opaque_vec_ptr()), - T_opaque_vec_ptr(), T_bool()), + T_opaque_vec_ptr(), T_bool()], T_void()); auto llfn = decl_fastcall_fn(llmod, abi::vec_append_glue_name(), ty); @@ -7660,41 +7660,41 @@ fn make_vec_append_glue(ModuleRef llmod, type_names tn) -> ValueRef { fn vec_fill(&@block_ctxt bcx, ValueRef v) -> ValueRef { - ret bcx.build.Load(bcx.build.GEP(v, vec(C_int(0), - C_int(abi::vec_elt_fill)))); + ret bcx.build.Load(bcx.build.GEP(v, [C_int(0), + C_int(abi::vec_elt_fill)])); } fn put_vec_fill(&@block_ctxt bcx, ValueRef v, ValueRef fill) -> ValueRef { ret bcx.build.Store(fill, bcx.build.GEP(v, - vec(C_int(0), - C_int(abi::vec_elt_fill)))); + [C_int(0), + C_int(abi::vec_elt_fill)])); } fn vec_fill_adjusted(&@block_ctxt bcx, ValueRef v, ValueRef skipnull) -> ValueRef { auto f = bcx.build.Load(bcx.build.GEP(v, - vec(C_int(0), - C_int(abi::vec_elt_fill)))); + [C_int(0), + C_int(abi::vec_elt_fill)])); ret bcx.build.Select(skipnull, bcx.build.Sub(f, C_int(1)), f); } fn vec_p0(&@block_ctxt bcx, ValueRef v) -> ValueRef { - auto p = bcx.build.GEP(v, vec(C_int(0), - C_int(abi::vec_elt_data))); + auto p = bcx.build.GEP(v, [C_int(0), + C_int(abi::vec_elt_data)]); ret bcx.build.PointerCast(p, T_ptr(T_i8())); } fn vec_p1(&@block_ctxt bcx, ValueRef v) -> ValueRef { auto len = vec_fill(bcx, v); - ret bcx.build.GEP(vec_p0(bcx, v), vec(len)); + ret bcx.build.GEP(vec_p0(bcx, v), [len]); } fn vec_p1_adjusted(&@block_ctxt bcx, ValueRef v, ValueRef skipnull) -> ValueRef { auto len = vec_fill_adjusted(bcx, v, skipnull); - ret bcx.build.GEP(vec_p0(bcx, v), vec(len)); + ret bcx.build.GEP(vec_p0(bcx, v), [len]); } fn trans_vec_append_glue(@local_ctxt cx) { @@ -7739,9 +7739,9 @@ fn trans_vec_append_glue(@local_ctxt cx) { auto llcopy_dst_ptr = alloca(bcx, T_int()); auto llnew_vec = bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.vec_grow, - vec(bcx.fcx.lltaskptr, lldst_vec, + [bcx.fcx.lltaskptr, lldst_vec, vec_fill_adjusted(bcx, llsrc_vec, llskipnull), - llcopy_dst_ptr, llvec_tydesc)); + llcopy_dst_ptr, llvec_tydesc]); maybe_name_value(bcx.fcx.lcx.ccx, llnew_vec, "llnew_vec"); auto copy_dst_cx = new_sub_block_ctxt(bcx, "copy new <- dst"); @@ -7764,19 +7764,19 @@ fn trans_vec_append_glue(@local_ctxt cx) { ValueRef src, ValueRef n_bytes) -> result { - auto src_lim = cx.build.GEP(src, vec(n_bytes)); + auto src_lim = cx.build.GEP(src, [n_bytes]); maybe_name_value(cx.fcx.lcx.ccx, src_lim, "src_lim"); auto elt_llsz = cx.build.Load(cx.build.GEP(elt_tydesc, - vec(C_int(0), - C_int(abi::tydesc_field_size)))); + [C_int(0), + C_int(abi::tydesc_field_size)])); maybe_name_value(cx.fcx.lcx.ccx, elt_llsz, "elt_llsz"); auto elt_llalign = cx.build.Load(cx.build.GEP(elt_tydesc, - vec(C_int(0), - C_int(abi::tydesc_field_align)))); + [C_int(0), + C_int(abi::tydesc_field_align)])); maybe_name_value(cx.fcx.lcx.ccx, elt_llsz, "elt_llalign"); @@ -7841,11 +7841,11 @@ fn make_glues(ModuleRef llmod, &type_names tn) -> @glue_fns { ret @rec(activate_glue = decl_glue(llmod, tn, abi::activate_glue_name()), yield_glue = decl_glue(llmod, tn, abi::yield_glue_name()), exit_task_glue = decl_cdecl_fn(llmod, abi::exit_task_glue_name(), - T_fn(vec(T_int(), + T_fn([T_int(), T_int(), T_int(), T_int(), - T_int()), + T_int()], T_void())), native_glues_rust = @@ -7889,18 +7889,18 @@ fn make_common_glue(&session::session sess, &str output) { } fn create_module_map(&@crate_ctxt ccx) -> ValueRef { - auto elttype = T_struct(vec(T_int(), T_int())); + auto elttype = T_struct([T_int(), T_int()]); auto maptype = T_array(elttype, ccx.module_data.size() + 1u); auto map = llvm::LLVMAddGlobal(ccx.llmod, maptype, _str::buf("_rust_mod_map")); llvm::LLVMSetLinkage(map, lib::llvm::LLVMInternalLinkage as llvm::Linkage); - let vec[ValueRef] elts = vec(); + let vec[ValueRef] elts = []; for each (@tup(str, ValueRef) item in ccx.module_data.items()) { - auto elt = C_struct(vec(p2i(C_cstr(ccx, item._0)), p2i(item._1))); + auto elt = C_struct([p2i(C_cstr(ccx, item._0)), p2i(item._1)]); _vec::push[ValueRef](elts, elt); } - auto term = C_struct(vec(C_int(0), C_int(0))); + auto term = C_struct([C_int(0), C_int(0)]); _vec::push[ValueRef](elts, term); llvm::LLVMSetInitializer(map, C_array(elttype, elts)); ret map; @@ -7917,7 +7917,7 @@ fn crate_name(&@crate_ctxt ccx, &str deflt) -> str { // FIXME use hashed metadata instead of crate names once we have that fn create_crate_map(&@crate_ctxt ccx) -> ValueRef { - let vec[ValueRef] subcrates = vec(); + let vec[ValueRef] subcrates = []; auto i = 1; while (ccx.sess.has_external_crate(i)) { auto name = ccx.sess.get_external_crate(i).name; @@ -7929,12 +7929,12 @@ fn create_crate_map(&@crate_ctxt ccx) -> ValueRef { _vec::push[ValueRef](subcrates, C_int(0)); auto sym_name = "_rust_crate_map_" + crate_name(ccx, "__none__"); auto arrtype = T_array(T_int(), _vec::len[ValueRef](subcrates)); - auto maptype = T_struct(vec(T_int(), arrtype)); + auto maptype = T_struct([T_int(), arrtype]); auto map = llvm::LLVMAddGlobal(ccx.llmod, maptype, _str::buf(sym_name)); llvm::LLVMSetLinkage(map, lib::llvm::LLVMExternalLinkage as llvm::Linkage); - llvm::LLVMSetInitializer(map, C_struct(vec(p2i(create_module_map(ccx)), - C_array(T_int(), subcrates)))); + llvm::LLVMSetInitializer(map, C_struct([p2i(create_module_map(ccx)), + C_array(T_int(), subcrates)])); ret map; } diff --git a/src/comp/middle/ty.rs b/src/comp/middle/ty.rs index 1c947e693efd..ee02a21ace32 100644 --- a/src/comp/middle/ty.rs +++ b/src/comp/middle/ty.rs @@ -420,9 +420,9 @@ fn mk_tup(&ctxt cx, &vec[mt] tms) -> t { ret gen_ty(cx, ty_tup(tms)); } fn mk_imm_tup(&ctxt cx, &vec[t] tys) -> t { // TODO: map - let vec[ty::mt] mts = vec(); + let vec[ty::mt] mts = []; for (t typ in tys) { - mts += vec(rec(ty=typ, mut=ast::imm)); + mts += [rec(ty=typ, mut=ast::imm)]; } ret mk_tup(cx, mts); } @@ -625,12 +625,12 @@ fn ty_to_str(ctxt cx, &t typ) -> str { } case (ty_param(?id)) { - s += "'" + _str::unsafe_from_bytes(vec(('a' as u8) + (id as u8))); + s += "'" + _str::unsafe_from_bytes([('a' as u8) + (id as u8)]); } case (ty_bound_param(?id)) { - s += "''" + _str::unsafe_from_bytes(vec(('a' as u8) + - (id as u8))); + s += "''" + _str::unsafe_from_bytes([('a' as u8) + + (id as u8)]); } } @@ -693,7 +693,7 @@ fn walk_ty(ctxt cx, ty_walk walker, t ty) { walk_ty(cx, walker, ret_ty); } case (ty_obj(?methods)) { - let vec[method] new_methods = vec(); + let vec[method] new_methods = []; for (method m in methods) { for (arg a in m.inputs) { walk_ty(cx, walker, a.ty); @@ -740,58 +740,58 @@ fn fold_ty(ctxt cx, ty_fold fld, t ty_0) -> t { ty = copy_cname(cx, mk_chan(cx, fold_ty(cx, fld, subty)), ty); } case (ty_tag(?tid, ?subtys)) { - let vec[t] new_subtys = vec(); + let vec[t] new_subtys = []; for (t subty in subtys) { - new_subtys += vec(fold_ty(cx, fld, subty)); + new_subtys += [fold_ty(cx, fld, subty)]; } ty = copy_cname(cx, mk_tag(cx, tid, new_subtys), ty); } case (ty_tup(?mts)) { - let vec[mt] new_mts = vec(); + let vec[mt] new_mts = []; for (mt tm in mts) { auto new_subty = fold_ty(cx, fld, tm.ty); - new_mts += vec(rec(ty=new_subty, mut=tm.mut)); + new_mts += [rec(ty=new_subty, mut=tm.mut)]; } ty = copy_cname(cx, mk_tup(cx, new_mts), ty); } case (ty_rec(?fields)) { - let vec[field] new_fields = vec(); + let vec[field] new_fields = []; for (field fl in fields) { auto new_ty = fold_ty(cx, fld, fl.mt.ty); auto new_mt = rec(ty=new_ty, mut=fl.mt.mut); - new_fields += vec(rec(ident=fl.ident, mt=new_mt)); + new_fields += [rec(ident=fl.ident, mt=new_mt)]; } ty = copy_cname(cx, mk_rec(cx, new_fields), ty); } case (ty_fn(?proto, ?args, ?ret_ty)) { - let vec[arg] new_args = vec(); + let vec[arg] new_args = []; for (arg a in args) { auto new_ty = fold_ty(cx, fld, a.ty); - new_args += vec(rec(mode=a.mode, ty=new_ty)); + new_args += [rec(mode=a.mode, ty=new_ty)]; } ty = copy_cname(cx, mk_fn(cx, proto, new_args, fold_ty(cx, fld, ret_ty)), ty); } case (ty_native_fn(?abi, ?args, ?ret_ty)) { - let vec[arg] new_args = vec(); + let vec[arg] new_args = []; for (arg a in args) { auto new_ty = fold_ty(cx, fld, a.ty); - new_args += vec(rec(mode=a.mode, ty=new_ty)); + new_args += [rec(mode=a.mode, ty=new_ty)]; } ty = copy_cname(cx, mk_native_fn(cx, abi, new_args, fold_ty(cx, fld, ret_ty)), ty); } case (ty_obj(?methods)) { - let vec[method] new_methods = vec(); + let vec[method] new_methods = []; for (method m in methods) { - let vec[arg] new_args = vec(); + let vec[arg] new_args = []; for (arg a in m.inputs) { - new_args += vec(rec(mode=a.mode, - ty=fold_ty(cx, fld, a.ty))); + new_args += [rec(mode=a.mode, + ty=fold_ty(cx, fld, a.ty))]; } - new_methods += vec(rec(proto=m.proto, ident=m.ident, + new_methods += [rec(proto=m.proto, ident=m.ident, inputs=new_args, - output=fold_ty(cx, fld, m.output))); + output=fold_ty(cx, fld, m.output))]; } ty = copy_cname(cx, mk_obj(cx, new_methods), ty); } @@ -1443,7 +1443,7 @@ fn ann_to_type(&node_type_table ntt, &ast::ann ann) -> t { fn ann_to_type_params(&node_type_table ntt, &ast::ann ann) -> vec[t] { alt (ann_to_ty_param_substs_opt_and_ty(ntt, ann)._0) { case (none[vec[t]]) { - let vec[t] result = vec(); + let vec[t] result = []; ret result; } case (some[vec[t]](?tps)) { ret tps; } @@ -1492,14 +1492,14 @@ fn count_ty_params(ctxt cx, t ty) -> uint { } } if (!seen) { - *param_indices += vec(param_idx); + *param_indices += [param_idx]; } } case (_) { /* fall through */ } } } - let vec[uint] v = vec(); // FIXME: typechecker botch + let vec[uint] v = []; // FIXME: typechecker botch let @mutable vec[uint] param_indices = @mutable v; auto f = bind counter(cx, param_indices, _); walk_ty(cx, f, ty); @@ -1873,7 +1873,7 @@ mod unify { } // TODO: as above, we should have an iter2 iterator. - let vec[arg] result_ins = vec(); + let vec[arg] result_ins = []; auto i = 0u; while (i < expected_len) { auto expected_input = expected_inputs.(i); @@ -1897,7 +1897,7 @@ mod unify { alt (result) { case (ures_ok(?rty)) { - result_ins += vec(rec(mode=result_mode, ty=rty)); + result_ins += [rec(mode=result_mode, ty=rty)]; } case (_) { @@ -1979,7 +1979,7 @@ mod unify { &t actual, &vec[method] expected_meths, &vec[method] actual_meths) -> result { - let vec[method] result_meths = vec(); + let vec[method] result_meths = []; let uint i = 0u; let uint expected_len = _vec::len[method](expected_meths); let uint actual_len = _vec::len[method](actual_meths); @@ -2004,9 +2004,9 @@ mod unify { case (ures_ok(?tfn)) { alt (struct(cx.tcx, tfn)) { case (ty_fn(?proto, ?ins, ?out)) { - result_meths += vec(rec(inputs = ins, + result_meths += [rec(inputs = ins, output = out - with e_meth)); + with e_meth)]; } } } @@ -2057,10 +2057,10 @@ mod unify { // Just bind the type variable to the expected type. auto vlen = _vec::len[vec[t]](cx.types); if (actual_n < vlen) { - cx.types.(actual_n) += vec(expected); + cx.types.(actual_n) += [expected]; } else { assert (actual_n == vlen); - cx.types += vec(mutable vec(expected)); + cx.types += [mutable [expected]]; } } } @@ -2120,7 +2120,7 @@ mod unify { // TODO: factor this cruft out, see the TODO in the // ty::ty_tup case - let vec[t] result_tps = vec(); + let vec[t] result_tps = []; auto i = 0u; auto expected_len = _vec::len[t](expected_tps); while (i < expected_len) { @@ -2272,7 +2272,7 @@ mod unify { // TODO: implement an iterator that can iterate over // two arrays simultaneously. - let vec[ty::mt] result_elems = vec(); + let vec[ty::mt] result_elems = []; auto i = 0u; while (i < expected_len) { auto expected_elem = expected_elems.(i); @@ -2294,7 +2294,7 @@ mod unify { alt (result) { case (ures_ok(?rty)) { auto mt = rec(ty=rty, mut=mut); - result_elems += vec(mt); + result_elems += [mt]; } case (_) { ret result; @@ -2326,7 +2326,7 @@ mod unify { // TODO: implement an iterator that can iterate over // two arrays simultaneously. - let vec[field] result_fields = vec(); + let vec[field] result_fields = []; auto i = 0u; while (i < expected_len) { auto expected_field = expected_fields.(i); @@ -2425,10 +2425,10 @@ mod unify { auto expected_n = get_or_create_set(cx, expected_id); auto vlen = _vec::len[vec[t]](cx.types); if (expected_n < vlen) { - cx.types.(expected_n) += vec(actual); + cx.types.(expected_n) += [actual]; } else { assert (expected_n == vlen); - cx.types += vec(mutable vec(actual)); + cx.types += [mutable [actual]]; } ret ures_ok(expected); } @@ -2485,13 +2485,13 @@ mod unify { } fn unify_sets(&@ctxt cx) -> vec[t] { - let vec[t] throwaway = vec(); - let vec[mutable vec[t]] set_types = vec(mutable throwaway); + let vec[t] throwaway = []; + let vec[mutable vec[t]] set_types = [mutable throwaway]; _vec::pop[vec[t]](set_types); // FIXME: botch for (ufind::node node in cx.sets.nodes) { - let vec[t] v = vec(); - set_types += vec(mutable v); + let vec[t] v = []; + set_types += [mutable v]; } auto i = 0u; @@ -2501,14 +2501,14 @@ mod unify { i += 1u; } - let vec[t] result = vec(); + let vec[t] result = []; for (vec[t] types in set_types) { if (_vec::len[t](types) > 1u) { log_err "unification of > 1 types in a type set is " + "unimplemented"; fail; } - result += vec(types.(0)); + result += [types.(0)]; } ret result; @@ -2518,8 +2518,8 @@ mod unify { &t actual, &unify_handler handler, &ty_ctxt tcx) -> result { - let vec[t] throwaway = vec(); - let vec[mutable vec[t]] types = vec(mutable throwaway); + let vec[t] throwaway = []; + let vec[mutable vec[t]] types = [mutable throwaway]; _vec::pop[vec[t]](types); // FIXME: botch auto cx = @rec(sets=ufind::make(), diff --git a/src/comp/middle/type_glue.rs b/src/comp/middle/type_glue.rs index d9f16bb3bcd6..d9c144f3fbfb 100644 --- a/src/comp/middle/type_glue.rs +++ b/src/comp/middle/type_glue.rs @@ -37,17 +37,17 @@ fn rc_shape_of(&ty::ctxt tcx, variant_getter getter, ty::t t) -> rc_shape { case (ty::ty_char) { ret rs_none; } case (ty::ty_str) { ret rs_none; } case (ty::ty_tag(?did, ?params)) { - let vec[vec[@rc_shape]] result = vec(); + let vec[vec[@rc_shape]] result = []; auto vinfos = getter(did); for (variant_info vinfo in vinfos) { - let vec[@rc_shape] variant_rcs = vec(); + let vec[@rc_shape] variant_rcs = []; for (ty::t typ in vinfo.args) { auto ty_1 = ty::bind_params_in_type(tcx, typ); ty_1 = ty::substitute_type_params(tcx, params, ty_1); - variant_rcs += vec(@rc_shape_of(tcx, getter, ty_1)); + variant_rcs += [@rc_shape_of(tcx, getter, ty_1)]; } - result += vec(variant_rcs); + result += [variant_rcs]; } ret rs_tag(result); @@ -58,16 +58,16 @@ fn rc_shape_of(&ty::ctxt tcx, variant_getter getter, ty::t t) -> rc_shape { case (ty::ty_chan(_)) { ret rs_ref; } case (ty::ty_task) { ret rs_ref; } case (ty::ty_tup(?mts)) { - let vec[@rc_shape] result = vec(); + let vec[@rc_shape] result = []; for (ty::mt tm in mts) { - result += vec(@rc_shape_of(tcx, getter, tm.ty)); + result += [@rc_shape_of(tcx, getter, tm.ty)]; } ret rs_tup(result); } case (ty::ty_rec(?fields)) { - let vec[@rc_shape] result = vec(); + let vec[@rc_shape] result = []; for (ty::field fld in fields) { - result += vec(@rc_shape_of(tcx, getter, fld.mt.ty)); + result += [@rc_shape_of(tcx, getter, fld.mt.ty)]; } ret rs_tup(result); } diff --git a/src/comp/middle/typeck.rs b/src/comp/middle/typeck.rs index 4b1eea9e2fd4..42a06d398fd5 100644 --- a/src/comp/middle/typeck.rs +++ b/src/comp/middle/typeck.rs @@ -188,10 +188,10 @@ fn instantiate_path(&@fn_ctxt fcx, &ast::path pth, &ty_param_count_and_ty tpt, auto ty_substs_opt; auto ty_substs_len = _vec::len[@ast::ty](pth.node.types); if (ty_substs_len > 0u) { - let vec[ty::t] ty_substs = vec(); + let vec[ty::t] ty_substs = []; auto i = 0u; while (i < ty_substs_len) { - ty_substs += vec(ast_ty_to_ty_crate(fcx.ccx, pth.node.types.(i))); + ty_substs += [ast_ty_to_ty_crate(fcx.ccx, pth.node.types.(i))]; i += 1u; } ty_substs_opt = some[vec[ty::t]](ty_substs); @@ -203,10 +203,10 @@ fn instantiate_path(&@fn_ctxt fcx, &ast::path pth, &ty_param_count_and_ty tpt, } } else { // We will acquire the type parameters through unification. - let vec[ty::t] ty_substs = vec(); + let vec[ty::t] ty_substs = []; auto i = 0u; while (i < ty_param_count) { - ty_substs += vec(next_ty_var(fcx.ccx)); + ty_substs += [next_ty_var(fcx.ccx)]; i += 1u; } ty_substs_opt = some[vec[ty::t]](ty_substs); @@ -259,9 +259,9 @@ fn ast_ty_to_ty(&ty::ctxt tcx, &ty_getter getter, &@ast::ty ast_ty) -> ty::t { // TODO: Make sure the number of supplied bindings matches the number // of type parameters in the typedef. Emit a friendly error otherwise. auto bound_ty = bind_params_in_type(tcx, params_opt_and_ty._1); - let vec[ty::t] param_bindings = vec(); + let vec[ty::t] param_bindings = []; for (@ast::ty ast_ty in args) { - param_bindings += vec(ast_ty_to_ty(tcx, getter, ast_ty)); + param_bindings += [ast_ty_to_ty(tcx, getter, ast_ty)]; } ret ty::substitute_type_params(tcx, param_bindings, bound_ty); } @@ -294,14 +294,14 @@ fn ast_ty_to_ty(&ty::ctxt tcx, &ty_getter getter, &@ast::ty ast_ty) -> ty::t { } case (ast::ty_tup(?fields)) { - let vec[ty::mt] flds = vec(); + let vec[ty::mt] flds = []; for (ast::mt field in fields) { _vec::push[ty::mt](flds, ast_mt_to_mt(tcx, getter, field)); } typ = ty::mk_tup(tcx, flds); } case (ast::ty_rec(?fields)) { - let vec[field] flds = vec(); + let vec[field] flds = []; for (ast::ty_field f in fields) { auto tm = ast_mt_to_mt(tcx, getter, f.mt); _vec::push[field](flds, rec(ident=f.ident, mt=tm)); @@ -336,7 +336,7 @@ fn ast_ty_to_ty(&ty::ctxt tcx, &ty_getter getter, &@ast::ty ast_ty) -> ty::t { } case (ast::ty_obj(?meths)) { - let vec[ty::method] tmeths = vec(); + let vec[ty::method] tmeths = []; auto f = bind ast_arg_to_arg(tcx, getter, _); for (ast::ty_method m in meths) { auto ins = _vec::map[ast::ty_arg, arg](f, m.inputs); @@ -502,7 +502,7 @@ mod collect { -> ty::ty_param_count_and_ty { auto t_obj = ty_of_obj(cx, id, obj_info, ty_params); - let vec[arg] t_inputs = vec(); + let vec[arg] t_inputs = []; for (ast::obj_field f in obj_info.fields) { auto g = bind getter(cx, _); auto t_field = ast_ty_to_ty(cx.tcx, g, f.ty); @@ -561,11 +561,11 @@ mod collect { case (ast::item_tag(_, _, ?tps, ?def_id, _)) { // Create a new generic polytype. - let vec[ty::t] subtys = vec(); + let vec[ty::t] subtys = []; auto i = 0u; for (ast::ty_param tp in tps) { - subtys += vec(ty::mk_param(cx.tcx, i)); + subtys += [ty::mk_param(cx.tcx, i)]; i += 1u; } @@ -613,13 +613,13 @@ mod collect { &vec[ast::variant] variants, &vec[ast::ty_param] ty_params) -> vec[ast::variant] { - let vec[ast::variant] result = vec(); + let vec[ast::variant] result = []; // Create a set of parameter types shared among all the variants. - let vec[ty::t] ty_param_tys = vec(); + let vec[ty::t] ty_param_tys = []; auto i = 0u; for (ast::ty_param tp in ty_params) { - ty_param_tys += vec(ty::mk_param(cx.tcx, i)); + ty_param_tys += [ty::mk_param(cx.tcx, i)]; i += 1u; } @@ -636,10 +636,10 @@ mod collect { // should be called to resolve named types. auto f = bind getter(cx, _); - let vec[arg] args = vec(); + let vec[arg] args = []; for (ast::variant_arg va in variant.node.args) { auto arg_ty = ast_ty_to_ty(cx.tcx, f, va.ty); - args += vec(rec(mode=ty::mo_alias, ty=arg_ty)); + args += [rec(mode=ty::mo_alias, ty=arg_ty)]; } auto tag_t = ty::mk_tag(cx.tcx, tag_id, ty_param_tys); result_ty = ty::mk_fn(cx.tcx, ast::proto_fn, args, tag_t); @@ -653,7 +653,7 @@ mod collect { ); write_type_only(cx.node_types, ast::ann_tag(variant.node.ann), result_ty); - result += vec(fold::respan(variant.span, variant_t)); + result += [fold::respan(variant.span, variant_t)]; } ret result; @@ -750,7 +750,7 @@ mod collect { case (none[@ast::method]) { /* nothing to do */ } case (some[@ast::method](?m)) { // TODO: typechecker botch - let vec[arg] no_args = vec(); + let vec[arg] no_args = []; auto t = ty::mk_fn(cx.tcx, ast::proto_fn, no_args, ty::mk_nil(cx.tcx)); write_type_only(cx.node_types, @@ -795,7 +795,7 @@ mod collect { auto id_to_ty_item = @common::new_def_hash[any_item](); let vec[mutable option::t[ty::ty_param_substs_opt_and_ty]] ntt_sub = - vec(mutable); + [mutable]; let node_type_table ntt = @mutable ntt_sub; auto visit = rec( @@ -837,7 +837,7 @@ mod unify { &ty::t actual) -> ty::unify::result { // FIXME: horrid botch let vec[mutable ty::t] param_substs = - vec(mutable ty::mk_nil(fcx.ccx.tcx)); + [mutable ty::mk_nil(fcx.ccx.tcx)]; _vec::pop(param_substs); ret with_params(fcx, expected, actual, param_substs); } @@ -884,9 +884,9 @@ mod unify { } // TODO: "freeze" - let vec[ty::t] param_substs_1 = vec(); + let vec[ty::t] param_substs_1 = []; for (ty::t subst in param_substs) { - param_substs_1 += vec(subst); + param_substs_1 += [subst]; } unified_type = @@ -968,13 +968,13 @@ type ty_param_substs_and_ty = tup(vec[ty::t], ty::t); mod Demand { fn simple(&@fn_ctxt fcx, &span sp, &ty::t expected, &ty::t actual) -> ty::t { - let vec[ty::t] tps = vec(); + let vec[ty::t] tps = []; ret full(fcx, sp, expected, actual, tps, NO_AUTODEREF)._1; } fn autoderef(&@fn_ctxt fcx, &span sp, &ty::t expected, &ty::t actual, autoderef_kind adk) -> ty::t { - let vec[ty::t] tps = vec(); + let vec[ty::t] tps = []; ret full(fcx, sp, expected, actual, tps, adk)._1; } @@ -996,18 +996,18 @@ mod Demand { } let vec[mutable ty::t] ty_param_substs = - vec(mutable ty::mk_nil(fcx.ccx.tcx)); + [mutable ty::mk_nil(fcx.ccx.tcx)]; _vec::pop(ty_param_substs); // FIXME: horrid botch for (ty::t ty_param_subst in ty_param_substs_0) { - ty_param_substs += vec(mutable ty_param_subst); + ty_param_substs += [mutable ty_param_subst]; } alt (unify::with_params(fcx, expected_1, actual_1, ty_param_substs)) { case (ures_ok(?t)) { // TODO: Use "freeze", when we have it. - let vec[ty::t] result_ty_param_substs = vec(); + let vec[ty::t] result_ty_param_substs = []; for (ty::t ty_param_subst in ty_param_substs) { - result_ty_param_substs += vec(ty_param_subst); + result_ty_param_substs += [ty_param_subst]; } ret tup(result_ty_param_substs, @@ -1042,7 +1042,7 @@ fn variant_arg_types(&@crate_ctxt ccx, &span sp, &ast::def_id vid, &vec[ty::t] tag_ty_params) -> vec[ty::t] { auto ty_param_count = _vec::len[ty::t](tag_ty_params); - let vec[ty::t] result = vec(); + let vec[ty::t] result = []; auto tpt = ty::lookup_item_type(ccx.sess, ccx.tcx, ccx.type_cache, vid); alt (struct(ccx.tcx, tpt._1)) { @@ -1052,7 +1052,7 @@ fn variant_arg_types(&@crate_ctxt ccx, &span sp, &ast::def_id vid, auto arg_ty = bind_params_in_type(ccx.tcx, arg.ty); arg_ty = substitute_ty_params(ccx, arg_ty, ty_param_count, tag_ty_params, sp); - result += vec(arg_ty); + result += [arg_ty]; } } case (_) { @@ -1163,11 +1163,11 @@ mod Pushdown { auto t = Demand::simple(fcx, e.span, expected, ann_to_type(fcx.ccx.node_types, ann)); - let vec[@ast::expr] es_1 = vec(); + let vec[@ast::expr] es_1 = []; alt (struct(fcx.ccx.tcx, t)) { case (ty::ty_vec(?mt)) { for (@ast::expr e_0 in es_0) { - es_1 += vec(pushdown_expr(fcx, mt.ty, e_0)); + es_1 += [pushdown_expr(fcx, mt.ty, e_0)]; } } case (_) { @@ -1182,14 +1182,14 @@ mod Pushdown { case (ast::expr_tup(?es_0, ?ann)) { auto t = Demand::simple(fcx, e.span, expected, ann_to_type(fcx.ccx.node_types, ann)); - let vec[ast::elt] elts_1 = vec(); + let vec[ast::elt] elts_1 = []; alt (struct(fcx.ccx.tcx, t)) { case (ty::ty_tup(?mts)) { auto i = 0u; for (ast::elt elt_0 in es_0) { auto e_1 = pushdown_expr(fcx, mts.(i).ty, elt_0.expr); - elts_1 += vec(rec(mut=elt_0.mut, expr=e_1)); + elts_1 += [rec(mut=elt_0.mut, expr=e_1)]; i += 1u; } } @@ -1207,7 +1207,7 @@ mod Pushdown { auto t = Demand::simple(fcx, e.span, expected, ann_to_type(fcx.ccx.node_types, ann)); - let vec[ast::field] fields_1 = vec(); + let vec[ast::field] fields_1 = []; alt (struct(fcx.ccx.tcx, t)) { case (ty::ty_rec(?field_mts)) { alt (base_0) { @@ -1220,9 +1220,9 @@ mod Pushdown { pushdown_expr(fcx, field_mts.(i).mt.ty, field_0.expr); - fields_1 += vec(rec(mut=field_0.mut, + fields_1 += [rec(mut=field_0.mut, ident=field_0.ident, - expr=e_1)); + expr=e_1)]; i += 1u; } } @@ -1231,7 +1231,7 @@ mod Pushdown { base_1 = some[@ast::expr] (pushdown_expr(fcx, t, bx)); - let vec[field] base_fields = vec(); + let vec[field] base_fields = []; for (ast::field field_0 in fields_0) { @@ -1242,9 +1242,9 @@ mod Pushdown { pushdown_expr(fcx, ft.mt.ty, field_0.expr); fields_1 += - vec(rec(mut=field_0.mut, + [rec(mut=field_0.mut, ident=field_0.ident, - expr=e_1)); + expr=e_1)]; } } } @@ -1479,13 +1479,13 @@ mod Pushdown { case (ast::expr_alt(?discrim, ?arms_0, ?ann)) { auto t = expected; - let vec[ast::arm] arms_1 = vec(); + let vec[ast::arm] arms_1 = []; for (ast::arm arm_0 in arms_0) { auto block_1 = pushdown_block(fcx, expected, arm_0.block); t = Demand::simple(fcx, e.span, t, block_ty(fcx.ccx.tcx, fcx.ccx.node_types, block_1)); auto arm_1 = rec(pat=arm_0.pat, block=block_1); - arms_1 += vec(arm_1); + arms_1 += [arm_1]; } e_1 = ast::expr_alt(discrim, arms_1, triv_ann(ast::ann_tag(ann), t)); @@ -1848,13 +1848,13 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { auto f_0 = check_expr(fcx, f); // Check the arguments and generate the argument signature. - let vec[option::t[@ast::expr]] args_0 = vec(); - let vec[arg] arg_tys_0 = vec(); + let vec[option::t[@ast::expr]] args_0 = []; + let vec[arg] arg_tys_0 = []; for (option::t[@ast::expr] a_opt in args) { alt (a_opt) { case (some[@ast::expr](?a)) { auto a_0 = check_expr(fcx, a); - args_0 += vec(some[@ast::expr](a_0)); + args_0 += [some[@ast::expr](a_0)]; auto arg_ty = rec(mode=mo_either, ty=expr_ty(fcx.ccx.tcx, @@ -1862,7 +1862,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { _vec::push[arg](arg_tys_0, arg_ty); } case (none[@ast::expr]) { - args_0 += vec(none[@ast::expr]); + args_0 += [none[@ast::expr]]; auto typ = next_ty_var(fcx.ccx); _vec::push[arg](arg_tys_0, rec(mode=mo_either, ty=typ)); @@ -1920,18 +1920,18 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { fn check_call(&@fn_ctxt fcx, &@ast::expr f, &vec[@ast::expr] args) -> tup(@ast::expr, vec[@ast::expr]) { - let vec[option::t[@ast::expr]] args_opt_0 = vec(); + let vec[option::t[@ast::expr]] args_opt_0 = []; for (@ast::expr arg in args) { - args_opt_0 += vec(some[@ast::expr](arg)); + args_opt_0 += [some[@ast::expr](arg)]; } // Call the generic checker. auto result = check_call_or_bind(fcx, f, args_opt_0); // Pull out the arguments. - let vec[@ast::expr] args_1 = vec(); + let vec[@ast::expr] args_1 = []; for (option::t[@ast::expr] arg in result._1) { - args_1 += vec(option::get[@ast::expr](arg)); + args_1 += [option::get[@ast::expr](arg)]; } ret tup(result._0, args_1); @@ -2397,12 +2397,12 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { auto pattern_ty = expr_ty(fcx.ccx.tcx, fcx.ccx.node_types, expr_0); - let vec[@ast::pat] pats = vec(); + let vec[@ast::pat] pats = []; for (ast::arm arm in arms) { check_pat(fcx, arm.pat); pattern_ty = Demand::simple(fcx, arm.pat.span, pattern_ty, pat_ty(fcx.ccx.tcx, fcx.ccx.node_types, arm.pat)); - pats += vec(arm.pat); + pats += [arm.pat]; } for (@ast::pat pat in pats) { @@ -2412,15 +2412,15 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { // Now typecheck the blocks. auto result_ty = next_ty_var(fcx.ccx); - let vec[ast::block] blocks_0 = vec(); + let vec[ast::block] blocks_0 = []; for (ast::arm arm in arms) { auto block_0 = check_block(fcx, arm.block); result_ty = Demand::simple(fcx, block_0.span, result_ty, block_ty(fcx.ccx.tcx, fcx.ccx.node_types, block_0)); - blocks_0 += vec(block_0); + blocks_0 += [block_0]; } - let vec[ast::arm] arms_1 = vec(); + let vec[ast::arm] arms_1 = []; auto i = 0u; for (ast::block block_0 in blocks_0) { auto block_1 = Pushdown::pushdown_block(fcx, result_ty, @@ -2428,7 +2428,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { auto pat = pats.(i); auto arm = arms.(i); auto arm_1 = rec(pat=pat, block=block_1); - arms_1 += vec(arm_1); + arms_1 += [arm_1]; i += 1u; } @@ -2464,7 +2464,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { // Pull the argument and return types out. auto proto_1; - let vec[ty::arg] arg_tys_1 = vec(); + let vec[ty::arg] arg_tys_1 = []; auto rt_1; alt (struct(fcx.ccx.tcx, expr_ty(fcx.ccx.tcx, fcx.ccx.node_types, result._0))) { @@ -2479,7 +2479,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { alt (args.(i)) { case (some[@ast::expr](_)) { /* no-op */ } case (none[@ast::expr]) { - arg_tys_1 += vec(arg_tys.(i)); + arg_tys_1 += [arg_tys.(i)]; } } i += 1u; @@ -2624,7 +2624,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { } case (ast::expr_vec(?args, ?mut, ?a)) { - let vec[@ast::expr] args_1 = vec(); + let vec[@ast::expr] args_1 = []; let ty::t t; if (_vec::len[@ast::expr](args) == 0u) { @@ -2650,15 +2650,15 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { } case (ast::expr_tup(?elts, ?a)) { - let vec[ast::elt] elts_1 = vec(); - let vec[ty::mt] elts_mt = vec(); + let vec[ast::elt] elts_1 = []; + let vec[ty::mt] elts_mt = []; for (ast::elt e in elts) { auto expr_1 = check_expr(fcx, e.expr); auto expr_t = expr_ty(fcx.ccx.tcx, fcx.ccx.node_types, expr_1); _vec::push[ast::elt](elts_1, rec(expr=expr_1 with e)); - elts_mt += vec(rec(ty=expr_t, mut=e.mut)); + elts_mt += [rec(ty=expr_t, mut=e.mut)]; } auto typ = ty::mk_tup(fcx.ccx.tcx, elts_mt); @@ -2678,8 +2678,8 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { } } - let vec[ast::field] fields_1 = vec(); - let vec[field] fields_t = vec(); + let vec[ast::field] fields_1 = []; + let vec[field] fields_t = []; for (ast::field f in fields) { auto expr_1 = check_expr(fcx, f.expr); @@ -2705,7 +2705,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr { auto bexpr_t = expr_ty(fcx.ccx.tcx, fcx.ccx.node_types, bexpr_1); - let vec[field] base_fields = vec(); + let vec[field] base_fields = []; alt (struct(fcx.ccx.tcx, bexpr_t)) { case (ty::ty_rec(?flds)) { @@ -3000,7 +3000,7 @@ fn check_stmt(&@fn_ctxt fcx, &@ast::stmt stmt) -> @ast::stmt { } fn check_block(&@fn_ctxt fcx, &ast::block block) -> ast::block { - let vec[@ast::stmt] stmts = vec(); + let vec[@ast::stmt] stmts = []; for (@ast::stmt s in block.node.stmts) { _vec::push[@ast::stmt](stmts, check_stmt(fcx, s)); } @@ -3093,10 +3093,10 @@ fn check_item_fn(&@crate_ctxt ccx, &span sp, &ast::ident ident, &ast::_fn f, // and return type translated to typeck::ty values. We don't need do to it // again here, we can extract them. - let vec[arg] inputs = vec(); + let vec[arg] inputs = []; for (ast::arg arg in f.decl.inputs) { auto input_ty = ast_ty_to_ty_crate(ccx, arg.ty); - inputs += vec(rec(mode=ast_mode_to_mode(arg.mode), ty=input_ty)); + inputs += [rec(mode=ast_mode_to_mode(arg.mode), ty=input_ty)]; } auto output_ty = ast_ty_to_ty_crate(ccx, f.decl.output); @@ -3182,7 +3182,7 @@ fn check_crate(&ty::ctxt tcx, &@ast::crate crate) -> typecheck_result { auto sess = tcx.sess; auto result = collect::collect_item_types(sess, tcx, crate); - let vec[ast::obj_field] fields = vec(); + let vec[ast::obj_field] fields = []; auto hasher = hash_unify_cache_entry; auto eqer = eq_unify_cache_entry; diff --git a/src/comp/middle/typestate_check.rs b/src/comp/middle/typestate_check.rs index c12d02737da0..4e89863e43f3 100644 --- a/src/comp/middle/typestate_check.rs +++ b/src/comp/middle/typestate_check.rs @@ -797,10 +797,10 @@ fn find_pre_post_loop(&def_map dm, &fn_info_map fm, &fn_info enclosing, find_pre_post_expr(dm, fm, enclosing, index); find_pre_post_block(dm, fm, enclosing, body); auto loop_precond = declare_var(enclosing, decl_lhs(d), - seq_preconds(enclosing, vec(expr_pp(index), - block_pp(body)))); + seq_preconds(enclosing, [expr_pp(index), + block_pp(body)])); auto loop_postcond = intersect_postconds - (vec(expr_postcond(index), block_postcond(body))); + ([expr_postcond(index), block_postcond(body)]); set_pre_and_post(a, rec(precondition=loop_precond, postcondition=loop_postcond)); } @@ -897,7 +897,7 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing, } // doesn't check that lhs is an lval, but // that's probably ok - find_pre_post_exprs(dm, fm, enclosing, vec(lhs, rhs), a); + find_pre_post_exprs(dm, fm, enclosing, [lhs, rhs], a); } case (expr_recv(?lhs, ?rhs, ?a)) { alt (lhs.node) { @@ -918,12 +918,12 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing, } // doesn't check that lhs is an lval, but // that's probably ok - find_pre_post_exprs(dm, fm, enclosing, vec(lhs, rhs), a); + find_pre_post_exprs(dm, fm, enclosing, [lhs, rhs], a); } case (expr_assign_op(_, ?lhs, ?rhs, ?a)) { /* Different from expr_assign in that the lhs *must* already be initialized */ - find_pre_post_exprs(dm, fm, enclosing, vec(lhs, rhs), a); + find_pre_post_exprs(dm, fm, enclosing, [lhs, rhs], a); } case (expr_lit(_,?a)) { set_pre_and_post(a, empty_pre_post(num_local_vars)); @@ -955,8 +955,8 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing, alt (maybe_alt) { case (none[@expr]) { auto precond_res = seq_preconds(enclosing, - vec(expr_pp(antec), - block_pp(conseq))); + [expr_pp(antec), + block_pp(conseq)]); set_pre_and_post(a, rec(precondition=precond_res, postcondition= expr_poststate(antec))); @@ -965,21 +965,21 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing, find_pre_post_expr(dm, fm, enclosing, altern); auto precond_true_case = seq_preconds(enclosing, - vec(expr_pp(antec), block_pp(conseq))); + [expr_pp(antec), block_pp(conseq)]); auto postcond_true_case = union_postconds (num_local_vars, - vec(expr_postcond(antec), block_postcond(conseq))); + [expr_postcond(antec), block_postcond(conseq)]); auto precond_false_case = seq_preconds (enclosing, - vec(expr_pp(antec), expr_pp(altern))); + [expr_pp(antec), expr_pp(altern)]); auto postcond_false_case = union_postconds (num_local_vars, - vec(expr_postcond(antec), expr_postcond(altern))); + [expr_postcond(antec), expr_postcond(altern)]); auto precond_res = union_postconds (num_local_vars, - vec(precond_true_case, precond_false_case)); + [precond_true_case, precond_false_case]); auto postcond_res = intersect_postconds - (vec(postcond_true_case, postcond_false_case)); + ([postcond_true_case, postcond_false_case]); set_pre_and_post(a, rec(precondition=precond_res, postcondition=postcond_res)); } @@ -988,10 +988,10 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing, case (expr_binary(?bop,?l,?r,?a)) { /* *unless* bop is lazy (e.g. and, or)? FIXME */ - find_pre_post_exprs(dm, fm, enclosing, vec(l, r), a); + find_pre_post_exprs(dm, fm, enclosing, [l, r], a); } case (expr_send(?l, ?r, ?a)) { - find_pre_post_exprs(dm, fm, enclosing, vec(l, r), a); + find_pre_post_exprs(dm, fm, enclosing, [l, r], a); } case (expr_unary(_,?operand,?a)) { find_pre_post_expr(dm, fm, enclosing, operand); @@ -1007,18 +1007,18 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing, set_pre_and_post(a, rec(precondition= seq_preconds(enclosing, - vec(expr_pp(test), - block_pp(body))), + [expr_pp(test), + block_pp(body)]), postcondition= - intersect_postconds(vec(expr_postcond(test), - block_postcond(body))))); + intersect_postconds([expr_postcond(test), + block_postcond(body)]))); } case (expr_do_while(?body, ?test, ?a)) { find_pre_post_block(dm, fm, enclosing, body); find_pre_post_expr(dm, fm, enclosing, test); auto loop_postcond = union_postconds(num_local_vars, - vec(block_postcond(body), expr_postcond(test))); + [block_postcond(body), expr_postcond(test)]); /* conservative approximination: if the body could break or cont, the test may never be executed */ if (has_nonlocal_exits(body)) { @@ -1027,8 +1027,8 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing, set_pre_and_post(a, rec(precondition=seq_preconds(enclosing, - vec(block_pp(body), - expr_pp(test))), + [block_pp(body), + expr_pp(test)]), postcondition=loop_postcond)); } case (expr_for(?d, ?index, ?body, ?a)) { @@ -1038,7 +1038,7 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing, find_pre_post_loop(dm, fm, enclosing, d, index, body, a); } case (expr_index(?e, ?sub, ?a)) { - find_pre_post_exprs(dm, fm, enclosing, vec(e, sub), a); + find_pre_post_exprs(dm, fm, enclosing, [e, sub], a); } case (expr_alt(?e, ?alts, ?a)) { find_pre_post_expr(dm, fm, enclosing, e); @@ -1053,7 +1053,7 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing, fn_info enclosing, &pre_and_post pp, &pre_and_post next) -> pre_and_post { union(pp.precondition, seq_preconds(enclosing, - vec(antec, next))); + [antec, next])); intersect(pp.postcondition, next.postcondition); ret pp; } @@ -1214,7 +1214,7 @@ fn find_pre_post_block(&def_map dm, &fn_info_map fm, &fn_info enclosing, auto do_inner = bind do_inner_(dm, fm, enclosing, _); option::map[@expr, ()](do_inner, b.node.expr); - let vec[pre_and_post] pps = vec(); + let vec[pre_and_post] pps = []; fn get_pp_stmt(&@stmt s) -> pre_and_post { ret stmt_pp(*s); @@ -1408,8 +1408,8 @@ fn find_pre_post_state_loop(&def_map dm, &fn_info_map fm, &fn_info enclosing, (poststate of index, poststate of body) */ changed = find_pre_post_state_block(dm, fm, enclosing, expr_poststate(index), body) || changed; - auto res_p = intersect_postconds(vec(expr_poststate(index), - block_poststate(body))); + auto res_p = intersect_postconds([expr_poststate(index), + block_poststate(body)]); changed = extend_poststate_ann(a, res_p) || changed; ret changed; @@ -1603,7 +1603,7 @@ fn find_pre_post_state_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing, changed = find_pre_post_state_expr(dm, fm, enclosing, expr_poststate(antec), altern) || changed; auto poststate_res = intersect_postconds - (vec(block_poststate(conseq), expr_poststate(altern))); + ([block_poststate(conseq), expr_poststate(altern)]); changed = extend_poststate_ann(a, poststate_res) || changed; } } @@ -1660,8 +1660,8 @@ fn find_pre_post_state_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing, changed = find_pre_post_state_block(dm, fm, enclosing, expr_poststate(test), body) || changed; changed = extend_poststate_ann(a, - intersect_postconds(vec(expr_poststate(test), - block_poststate(body)))) || changed; + intersect_postconds([expr_poststate(test), + block_poststate(body)])) || changed; ret changed; } case (expr_do_while(?body, ?test, ?a)) { @@ -2335,7 +2335,7 @@ fn annotate_stmt(&fn_info_map fm, &@stmt s) -> @stmt { } } fn annotate_block(&fn_info_map fm, &block b) -> block { - let vec[@stmt] new_stmts = vec(); + let vec[@stmt] new_stmts = []; for (@stmt s in b.node.stmts) { auto new_s = annotate_stmt(fm, s); @@ -2357,7 +2357,7 @@ fn annotate_fn(&fn_info_map fm, &ast::_fn f) -> ast::_fn { ret rec(body=annotate_block(fm, f.body) with f); } fn annotate_mod(&fn_info_map fm, &ast::_mod m) -> ast::_mod { - let vec[@item] new_items = vec(); + let vec[@item] new_items = []; for (@item i in m.items) { auto new_i = annotate_item(fm, i); @@ -2470,7 +2470,7 @@ fn annotate_item(&fn_info_map fm, &@ast::item item) -> @ast::item { } fn annotate_module(&fn_info_map fm, &ast::_mod module) -> ast::_mod { - let vec[@item] new_items = vec(); + let vec[@item] new_items = []; for (@item i in module.items) { auto new_item = annotate_item(fm, i); diff --git a/src/comp/pretty/pp.rs b/src/comp/pretty/pp.rs index aff0843d27d2..45b555439cda 100644 --- a/src/comp/pretty/pp.rs +++ b/src/comp/pretty/pp.rs @@ -31,9 +31,9 @@ type ps = @rec(mutable vec[context] context, mutable bool potential_brk); fn mkstate(io::writer out, uint width) -> ps { - let vec[context] stack = vec(rec(tp=cx_v, indent=0u)); - let vec[token] buff = vec(); - let vec[boxtype] sd = vec(); + let vec[context] stack = [rec(tp=cx_v, indent=0u)]; + let vec[token] buff = []; + let vec[boxtype] sd = []; ret @rec(mutable context=stack, width=width, out=out, @@ -81,7 +81,7 @@ fn direct_token(ps p, token tok) { } fn buffer_token(ps p, token tok) { - p.buffered += vec(tok); + p.buffered += [tok]; auto col = p.scancol; p.scancol = col + token_size(tok); if (p.scancol > p.width) { @@ -140,13 +140,13 @@ fn finish_scan(ps p, bool fits) { push_context(p, cx_h, base_indent(p) + ind); } } - p.scandepth = vec(); + p.scandepth = []; p.scanning = scan_none; for (token t in buf) { add_token(p, t); } } fn start_scan(ps p, token tok, scantype tp) { - p.buffered = vec(); + p.buffered = []; p.scancol = p.col; p.scanning = tp; buffer_token(p, tok); diff --git a/src/comp/pretty/pprust.rs b/src/comp/pretty/pprust.rs index c7c4fba36d3d..a6ab26dc618d 100644 --- a/src/comp/pretty/pprust.rs +++ b/src/comp/pretty/pprust.rs @@ -307,7 +307,7 @@ fn print_item(ps s, @ast::item item) { bopen(s); for (@ast::method meth in _obj.methods) { hbox(s); - let vec[ast::ty_param] typarams = vec(); + let vec[ast::ty_param] typarams = []; maybe_print_comment(s, meth.span.lo); print_fn(s, meth.node.meth.decl, meth.node.ident, typarams); space(s.s); @@ -360,7 +360,7 @@ fn print_literal(ps s, @ast::lit lit) { alt (lit.node) { case (ast::lit_str(?st)) {print_string(s, st);} case (ast::lit_char(?ch)) { - wrd(s.s, "'" + escape_str(_str::from_bytes(vec(ch as u8)), '\'') + wrd(s.s, "'" + escape_str(_str::from_bytes([ch as u8]), '\'') + "'"); } case (ast::lit_int(?val)) { diff --git a/src/comp/util/interner.rs b/src/comp/util/interner.rs index a9bf9bc4e333..59426664b4a6 100644 --- a/src/comp/util/interner.rs +++ b/src/comp/util/interner.rs @@ -20,7 +20,7 @@ type interner[T] = rec( fn mk_interner[T](hashfn[T] hasher, eqfn[T] eqer) -> interner[T] { auto m = map::mk_hashmap[T,uint](hasher, eqer); - let vec[T] vect = vec(); + let vec[T] vect = []; ret rec(map=m, mutable vect=vect, hasher=hasher, eqer=eqer); } @@ -30,7 +30,7 @@ fn intern[T](&interner[T] itr, &T val) -> uint { case (none[uint]) { auto new_idx = _vec::len[T](itr.vect); itr.map.insert(val, new_idx); - itr.vect += vec(val); + itr.vect += [val]; ret new_idx; } } diff --git a/src/lib/_str.rs b/src/lib/_str.rs index 36b2376d4dbe..1ab1b0144109 100644 --- a/src/lib/_str.rs +++ b/src/lib/_str.rs @@ -141,7 +141,7 @@ fn unsafe_from_bytes(vec[mutable? u8] v) -> str { } fn unsafe_from_byte(u8 u) -> str { - ret rustrt::str_from_vec(vec(u)); + ret rustrt::str_from_vec([u]); } fn str_from_cstr(sbuf cstr) -> str { @@ -248,7 +248,7 @@ fn char_len(str s) -> uint { } fn to_chars(str s) -> vec[char] { - let vec[char] buf = vec(); + let vec[char] buf = []; auto i = 0u; auto len = byte_len(s); while (i < len) { @@ -419,12 +419,12 @@ fn unshift_byte(&mutable str s, u8 b) { } fn split(str s, u8 sep) -> vec[str] { - let vec[str] v = vec(); + let vec[str] v = []; let str accum = ""; let bool ends_with_sep = false; for (u8 c in s) { if (c == sep) { - v += vec(accum); + v += [accum]; accum = ""; ends_with_sep = true; } else { @@ -434,7 +434,7 @@ fn split(str s, u8 sep) -> vec[str] { } if (_str::byte_len(accum) != 0u || ends_with_sep) { - v += vec(accum); + v += [accum]; } ret v; } @@ -486,5 +486,5 @@ fn to_upper(str s) -> str { // indent-tabs-mode: nil // c-basic-offset: 4 // buffer-file-coding-system: utf-8-unix -// compile-command: "make -k -C .. 2>&1 | sed -e 's/\\/x\\//x:\\//g'"; +// compile-command: "make -k -C $RBUILD 2>&1 | sed -e 's/\\/x\\//x:\\//g'"; // End: diff --git a/src/lib/_vec.rs b/src/lib/_vec.rs index 0988864a160d..70446e0f39fe 100644 --- a/src/lib/_vec.rs +++ b/src/lib/_vec.rs @@ -75,7 +75,7 @@ fn init_fn[T](&init_op[T] op, uint n_elts) -> vec[T] { let vec[T] v = alloc[T](n_elts); let uint i = 0u; while (i < n_elts) { - v += vec(op(i)); + v += [op(i)]; i += 1u; } ret v; @@ -85,7 +85,7 @@ fn init_fn_mut[T](&init_op[T] op, uint n_elts) -> vec[mutable T] { let vec[mutable T] v = alloc_mut[T](n_elts); let uint i = 0u; while (i < n_elts) { - v += vec(mutable op(i)); + v += [mutable op(i)]; i += 1u; } ret v; @@ -103,7 +103,7 @@ fn init_elt[T](&T t, uint n_elts) -> vec[T] { let uint i = n_elts; while (i > 0u) { i -= 1u; - v += vec(t); + v += [t]; } ret v; } @@ -113,7 +113,7 @@ fn init_elt_mut[T](&T t, uint n_elts) -> vec[mutable T] { let uint i = n_elts; while (i > 0u) { i -= 1u; - v += vec(mutable t); + v += [mutable t]; } ret v; } @@ -156,7 +156,7 @@ fn slice[T](array[T] v, uint start, uint end) -> vec[T] { auto result = alloc[T](end - start); let uint i = start; while (i < end) { - result += vec(v.(i)); + result += [v.(i)]; i += 1u; } ret result; @@ -180,12 +180,12 @@ fn pop[T](&mutable array[T] v) -> T { } fn push[T](&mutable array[T] v, &T t) { - v += vec(t); + v += [t]; } fn unshift[T](&mutable array[T] v, &T t) { auto res = alloc[T](len[T](v) + 1u); - res += vec(t); + res += [t]; res += v; v = res; } @@ -194,7 +194,7 @@ fn grow[T](&array[T] v, uint n, &T initval) { let uint i = n; while (i > 0u) { i -= 1u; - v += vec(initval); + v += [initval]; } } @@ -209,7 +209,7 @@ fn grow_set[T](&vec[mutable T] v, uint index, &T initval, &T val) { fn map[T, U](&option::operator[T,U] f, &array[T] v) -> vec[U] { let vec[U] u = alloc[U](len[T](v)); for (T ve in v) { - u += vec(f(ve)); + u += [f(ve)]; } ret u; } @@ -223,7 +223,7 @@ fn map2[T,U,V](&operator2[T,U,V] f, &array[T] v0, &array[U] v1) -> vec[V] { let vec[V] u = alloc[V](v0_len); auto i = 0u; while (i < v0_len) { - u += vec(f(v0.(i), v1.(i))); + u += [f(v0.(i), v1.(i))]; i += 1u; } @@ -262,8 +262,8 @@ fn unzip[T, U](&vec[tup(T, U)] v) -> tup(vec[T], vec[U]) { else { auto rest = slice[tup(T, U)](v, 1u, sz); auto tl = unzip[T, U](rest); - auto a = vec(v.(0)._0); - auto b = vec(v.(0)._1); + auto a = [v.(0)._0]; + auto b = [v.(0)._1]; ret tup(a + tl._0, b + tl._1); } } @@ -280,18 +280,18 @@ fn clone[T](&vec[T] v) -> vec[T] { fn plus_option[T](&vec[T] v, &option::t[T] o) -> () { alt (o) { case (none[T]) {} - case (some[T](?x)) { v += vec(x); } + case (some[T](?x)) { v += [x]; } } } fn cat_options[T](&vec[option::t[T]] v) -> vec[T] { - let vec[T] res = vec(); + let vec[T] res = []; for (option::t[T] o in v) { alt (o) { case (none[T]) { } case (some[T](?t)) { - res += vec(t); + res += [t]; } } } @@ -301,9 +301,9 @@ fn cat_options[T](&vec[option::t[T]] v) -> vec[T] { // TODO: Remove in favor of built-in "freeze" operation when it's implemented. fn freeze[T](vec[mutable T] v) -> vec[T] { - let vec[T] result = vec(); + let vec[T] result = []; for (T elem in v) { - result += vec(elem); + result += [elem]; } ret result; } diff --git a/src/lib/bitv.rs b/src/lib/bitv.rs index 1b4528a44a99..f34ce56524ed 100644 --- a/src/lib/bitv.rs +++ b/src/lib/bitv.rs @@ -217,6 +217,6 @@ fn eq_vec(&t v0, &vec[uint] v1) -> bool { // indent-tabs-mode: nil // c-basic-offset: 4 // buffer-file-coding-system: utf-8-unix -// compile-command: "make -k -C .. 2>&1 | sed -e 's/\\/x\\//x:\\//g'"; +// compile-command: "make -k -C $RBUILD 2>&1 | sed -e 's/\\/x\\//x:\\//g'"; // End: // diff --git a/src/lib/ebml.rs b/src/lib/ebml.rs index 0efb05b83c3f..0a5831d73333 100644 --- a/src/lib/ebml.rs +++ b/src/lib/ebml.rs @@ -122,22 +122,22 @@ fn write_sized_vint(&io::buf_writer w, uint n, uint size) { let vec[u8] buf; alt (size) { case (1u) { - buf = vec(0x80u8 | (n as u8)); + buf = [0x80u8 | (n as u8)]; } case (2u) { - buf = vec(0x40u8 | ((n >> 8u) as u8), - (n & 0xffu) as u8); + buf = [0x40u8 | ((n >> 8u) as u8), + (n & 0xffu) as u8]; } case (3u) { - buf = vec(0x20u8 | ((n >> 16u) as u8), + buf = [0x20u8 | ((n >> 16u) as u8), ((n >> 8u) & 0xffu) as u8, - (n & 0xffu) as u8); + (n & 0xffu) as u8]; } case (4u) { - buf = vec(0x10u8 | ((n >> 24u) as u8), + buf = [0x10u8 | ((n >> 24u) as u8), ((n >> 16u) & 0xffu) as u8, ((n >> 8u) & 0xffu) as u8, - (n & 0xffu) as u8); + (n & 0xffu) as u8]; } case (_) { log_err "vint to write too big"; @@ -158,7 +158,7 @@ fn write_vint(&io::buf_writer w, uint n) { } fn create_writer(&io::buf_writer w) -> writer { - let vec[uint] size_positions = vec(); + let vec[uint] size_positions = []; ret rec(writer=w, mutable size_positions=size_positions); } @@ -169,8 +169,8 @@ fn start_tag(&writer w, uint tag_id) { write_vint(w.writer, tag_id); // Write a placeholder four-byte size. - w.size_positions += vec(w.writer.tell()); - let vec[u8] zeroes = vec(0u8, 0u8, 0u8, 0u8); + w.size_positions += [w.writer.tell()]; + let vec[u8] zeroes = [0u8, 0u8, 0u8, 0u8]; w.writer.write(zeroes); } diff --git a/src/lib/extfmt.rs b/src/lib/extfmt.rs index 93d4d7de8d04..04c823c7cf13 100644 --- a/src/lib/extfmt.rs +++ b/src/lib/extfmt.rs @@ -79,14 +79,14 @@ mod ct { } fn parse_fmt_string(str s) -> vec[piece] { - let vec[piece] pieces = vec(); + let vec[piece] pieces = []; auto lim = _str::byte_len(s); auto buf = ""; fn flush_buf(str buf, &vec[piece] pieces) -> str { if (_str::byte_len(buf) > 0u) { auto piece = piece_string(buf); - pieces += vec(piece); + pieces += [piece]; } ret ""; } @@ -106,7 +106,7 @@ mod ct { } else { buf = flush_buf(buf, pieces); auto res = parse_conversion(s, i, lim); - pieces += vec(res._0); + pieces += [res._0]; i = res._1; } } else { @@ -180,7 +180,7 @@ mod ct { } fn parse_flags(str s, uint i, uint lim) -> tup(vec[flag], uint) { - let vec[flag] noflags = vec(); + let vec[flag] noflags = []; if (i >= lim) { ret tup(noflags, i); @@ -190,7 +190,7 @@ mod ct { auto next = parse_flags(s, i + 1u, lim); auto rest = next._0; auto j = next._1; - let vec[flag] curr = vec(f); + let vec[flag] curr = [f]; ret tup(curr + rest, j); } @@ -539,7 +539,7 @@ mod rt { || head == '-' as u8 || head == ' ' as u8) { - auto headstr = _str::unsafe_from_bytes(vec(head)); + auto headstr = _str::unsafe_from_bytes([head]); auto bytelen = _str::byte_len(s); auto numpart = _str::substr(s, 1u, bytelen - 1u); ret headstr + padstr + numpart; @@ -793,7 +793,7 @@ mod RT { || head == '-' as u8 || head == ' ' as u8) { - auto headstr = _str::unsafe_from_bytes(vec(head)); + auto headstr = _str::unsafe_from_bytes([head]); auto bytelen = _str::byte_len(s); auto numpart = _str::substr(s, 1u, bytelen - 1u); ret headstr + padstr + numpart; diff --git a/src/lib/fs.rs b/src/lib/fs.rs index a897576944b5..c726fc0985c6 100644 --- a/src/lib/fs.rs +++ b/src/lib/fs.rs @@ -36,7 +36,7 @@ fn list_dir(path p) -> vec[str] { if (pl == 0u || p.(pl - 1u) as char != os_fs::path_sep) { p += path_sep(); } - let vec[str] full_paths = vec(); + let vec[str] full_paths = []; for (str filename in os_fs::list_dir(p)) { if (!_str::eq(filename, ".")) {if (!_str::eq(filename, "..")) { _vec::push[str](full_paths, p + filename); diff --git a/src/lib/getopts.rs b/src/lib/getopts.rs index c1bcaae30c54..a553b7e4128b 100644 --- a/src/lib/getopts.rs +++ b/src/lib/getopts.rs @@ -106,7 +106,7 @@ fn getopts(vec[str] args, vec[opt] opts) -> result { fn empty_(uint x) -> vec[optval]{ret _vec::empty[optval]();} auto f = empty_; auto vals = _vec::init_fn_mut[vec[optval]](f, n_opts); - let vec[str] free = vec(); + let vec[str] free = []; auto l = _vec::len[str](args); auto i = 0u; @@ -125,15 +125,15 @@ fn getopts(vec[str] args, vec[opt] opts) -> result { auto tail = _str::slice(cur, 2u, curlen); auto eq = _str::index(tail, '=' as u8); if (eq == -1) { - names = vec(long(tail)); + names = [long(tail)]; } else { - names = vec(long(_str::slice(tail, 0u, eq as uint))); + names = [long(_str::slice(tail, 0u, eq as uint))]; i_arg = option::some[str] (_str::slice(tail, (eq as uint) + 1u, curlen - 2u)); } } else { auto j = 1u; - names = vec(); + names = []; while (j < curlen) { auto range = _str::char_range_at(cur, j); _vec::push[name](names, short(range._0)); @@ -221,7 +221,7 @@ fn opt_str(match m, str nm) -> str { } } fn opt_strs(match m, str nm) -> vec[str] { - let vec[str] acc = vec(); + let vec[str] acc = []; for (optval v in opt_vals(m, nm)) { alt (v) { case (val(?s)) { _vec::push[str](acc, s); } diff --git a/src/lib/io.rs b/src/lib/io.rs index c996584f8f05..57675916f467 100644 --- a/src/lib/io.rs +++ b/src/lib/io.rs @@ -120,7 +120,7 @@ state obj new_reader(buf_reader rdr) { ret rdr.eof(); } fn read_line() -> str { - let vec[u8] buf = vec(); + let vec[u8] buf = []; // No break yet in rustc auto go_on = true; while (go_on) { @@ -131,7 +131,7 @@ state obj new_reader(buf_reader rdr) { ret _str::unsafe_from_bytes(buf); } fn read_c_str() -> str { - let vec[u8] buf = vec(); + let vec[u8] buf = []; auto go_on = true; while (go_on) { auto ch = rdr.read_byte(); @@ -172,7 +172,7 @@ state obj new_reader(buf_reader rdr) { ret val; } fn read_whole_stream() -> vec[u8] { - let vec[u8] buf = vec(); + let vec[u8] buf = []; while (!rdr.eof()) { buf += rdr.read(2048u); } @@ -366,9 +366,9 @@ type writer = }; fn uint_to_le_bytes(uint n, uint size) -> vec[u8] { - let vec[u8] bytes = vec(); + let vec[u8] bytes = []; while (size > 0u) { - bytes += vec((n & 255u) as u8); + bytes += [(n & 255u) as u8]; n >>= 8u; size -= 1u; } @@ -376,10 +376,10 @@ fn uint_to_le_bytes(uint n, uint size) -> vec[u8] { } fn uint_to_be_bytes(uint n, uint size) -> vec[u8] { - let vec[u8] bytes = vec(); + let vec[u8] bytes = []; auto i = (size - 1u) as int; while (i >= 0) { - bytes += vec(((n >> ((i * 8) as uint)) & 255u) as u8); + bytes += [((n >> ((i * 8) as uint)) & 255u) as u8]; i -= 1; } ret bytes; @@ -466,7 +466,7 @@ state obj byte_buf_writer(mutable_byte_buf buf) { while (vpos < vlen) { auto b = v.(vpos); if (buf.pos == _vec::len(buf.buf)) { - buf.buf += vec(mutable b); + buf.buf += [mutable b]; } else { buf.buf.(buf.pos) = b; } @@ -486,7 +486,7 @@ state obj byte_buf_writer(mutable_byte_buf buf) { fn string_writer() -> str_writer { // FIXME: yikes, this is bad. Needs fixing of mutable syntax. - let vec[mutable u8] b = vec(mutable 0u8); + let vec[mutable u8] b = [mutable 0u8]; _vec::pop(b); let mutable_byte_buf buf = @rec(mutable buf = b, mutable pos = 0u); diff --git a/src/lib/linux_os.rs b/src/lib/linux_os.rs index 2a8921e3cbed..f014c9c0df2f 100644 --- a/src/lib/linux_os.rs +++ b/src/lib/linux_os.rs @@ -65,7 +65,7 @@ fn dylib_filename(str base) -> str { } fn pipe() -> tup(int, int) { - let vec[mutable int] fds = vec(mutable 0, 0); + let vec[mutable int] fds = [mutable 0, 0]; assert (os::libc::pipe(_vec::buf(fds)) == 0); ret tup(fds.(0), fds.(1)); } @@ -75,7 +75,7 @@ fn fd_FILE(int fd) -> libc::FILE { } fn waitpid(int pid) -> int { - let vec[mutable int] status = vec(mutable 0); + let vec[mutable int] status = [mutable 0]; assert (os::libc::waitpid(pid, _vec::buf(status), 0) != -1); ret status.(0); } diff --git a/src/lib/macos_os.rs b/src/lib/macos_os.rs index 04a143b8ea20..0e37051278b9 100644 --- a/src/lib/macos_os.rs +++ b/src/lib/macos_os.rs @@ -62,7 +62,7 @@ fn dylib_filename(str base) -> str { } fn pipe() -> tup(int, int) { - let vec[mutable int] fds = vec(mutable 0, 0); + let vec[mutable int] fds = [mutable 0, 0]; assert (os::libc::pipe(_vec::buf(fds)) == 0); ret tup(fds.(0), fds.(1)); } @@ -72,7 +72,7 @@ fn fd_FILE(int fd) -> libc::FILE { } fn waitpid(int pid) -> int { - let vec[mutable int] status = vec(mutable 0); + let vec[mutable int] status = [mutable 0]; assert (os::libc::waitpid(pid, _vec::buf(status), 0) != -1); ret status.(0); } diff --git a/src/lib/posix_fs.rs b/src/lib/posix_fs.rs index 1244dd1bd98d..7a0606ec8915 100644 --- a/src/lib/posix_fs.rs +++ b/src/lib/posix_fs.rs @@ -6,7 +6,7 @@ fn list_dir(str path) -> vec[str] { // TODO ensure this is always closed auto dir = os::libc::opendir(_str::buf(path)); assert (dir as uint != 0u); - let vec[str] result = vec(); + let vec[str] result = []; while (true) { auto ent = os::libc::readdir(dir); if (ent as int == 0) { diff --git a/src/lib/run_program.rs b/src/lib/run_program.rs index abcf1472067e..06fe23596c06 100644 --- a/src/lib/run_program.rs +++ b/src/lib/run_program.rs @@ -5,8 +5,8 @@ native "rust" mod rustrt { fn rust_run_program(vbuf argv, int in_fd, int out_fd, int err_fd) -> int; } -fn argvec(str prog, vec[str] args) -> vec[sbuf] { - auto argptrs = vec(_str::buf(prog)); +fn arg_vec(str prog, vec[str] args) -> vec[sbuf] { + auto argptrs = [_str::buf(prog)]; for (str arg in args) { _vec::push[sbuf](argptrs, _str::buf(arg)); } @@ -15,7 +15,7 @@ fn argvec(str prog, vec[str] args) -> vec[sbuf] { } fn run_program(str prog, vec[str] args) -> int { - auto pid = rustrt::rust_run_program(_vec::buf[sbuf](argvec(prog, args)), + auto pid = rustrt::rust_run_program(_vec::buf[sbuf](arg_vec(prog, args)), 0, 0, 0); ret os::waitpid(pid); } @@ -33,7 +33,7 @@ fn start_program(str prog, vec[str] args) -> @program { auto pipe_input = os::pipe(); auto pipe_output = os::pipe(); auto pid = rustrt::rust_run_program - (_vec::buf[sbuf](argvec(prog, args)), + (_vec::buf[sbuf](arg_vec(prog, args)), pipe_input._0, pipe_output._1, 0); if (pid == -1) {fail;} os::libc::close(pipe_input._0); @@ -92,5 +92,5 @@ fn program_output(str prog, vec[str] args) // indent-tabs-mode: nil // c-basic-offset: 4 // buffer-file-coding-system: utf-8-unix -// compile-command: "make -k -C .. 2>&1 | sed -e 's/\\/x\\//x:\\//g'"; +// compile-command: "make -k -C $RBUILD 2>&1 | sed -e 's/\\/x\\//x:\\//g'"; // End: diff --git a/src/lib/sha1.rs b/src/lib/sha1.rs index 96535d121f94..4ae004079c36 100644 --- a/src/lib/sha1.rs +++ b/src/lib/sha1.rs @@ -174,13 +174,13 @@ fn mk_sha1() -> sha1 { st.computed = true; } - let vec[u8] res = vec(); + let vec[u8] res = []; for (u32 hpart in st.h) { auto a = (hpart >> 24u32) & 0xFFu32 as u8; auto b = (hpart >> 16u32) & 0xFFu32 as u8; auto c = (hpart >> 8u32) & 0xFFu32 as u8; auto d = (hpart & 0xFFu32 as u8); - res += vec(a,b,c,d); + res += [a,b,c,d]; } ret res; } diff --git a/src/lib/sort.rs b/src/lib/sort.rs index 3b3c64036be2..f74a7d7df71c 100644 --- a/src/lib/sort.rs +++ b/src/lib/sort.rs @@ -6,17 +6,17 @@ type lteq[T] = fn(&T a, &T b) -> bool; fn merge_sort[T](lteq[T] le, vec[T] v) -> vec[T] { fn merge[T](lteq[T] le, vec[T] a, vec[T] b) -> vec[T] { - let vec[T] res = vec(); + let vec[T] res = []; let uint a_len = len[T](a); let uint a_ix = 0u; let uint b_len = len[T](b); let uint b_ix = 0u; while (a_ix < a_len && b_ix < b_len) { if (le(a.(a_ix), b.(b_ix))) { - res += vec(a.(a_ix)); + res += [a.(a_ix)]; a_ix += 1u; } else { - res += vec(b.(b_ix)); + res += [b.(b_ix)]; b_ix += 1u; } } diff --git a/src/lib/term.rs b/src/lib/term.rs index 6fd54a2d4e6f..46525e47bda2 100644 --- a/src/lib/term.rs +++ b/src/lib/term.rs @@ -22,12 +22,12 @@ const u8 color_bright_cyan = 14u8; const u8 color_bright_white = 15u8; fn esc(io::buf_writer writer) { - writer.write(vec(0x1bu8, '[' as u8)); + writer.write([0x1bu8, '[' as u8]); } fn reset(io::buf_writer writer) { esc(writer); - writer.write(vec('0' as u8, 'm' as u8)); + writer.write(['0' as u8, 'm' as u8]); } fn color_supported() -> bool { @@ -39,10 +39,10 @@ fn set_color(io::buf_writer writer, u8 first_char, u8 color) { esc(writer); if (color >= 8u8) { - writer.write(vec('1' as u8, ';' as u8)); + writer.write(['1' as u8, ';' as u8]); color -= 8u8; } - writer.write(vec(first_char, ('0' as u8) + color, 'm' as u8)); + writer.write([first_char, ('0' as u8) + color, 'm' as u8]); } fn fg(io::buf_writer writer, u8 color) { diff --git a/src/lib/ufind.rs b/src/lib/ufind.rs index faa77305b9ed..c7790049be22 100644 --- a/src/lib/ufind.rs +++ b/src/lib/ufind.rs @@ -7,14 +7,14 @@ type node = option::t[uint]; type ufind = rec(mutable vec[mutable node] nodes); fn make() -> ufind { - let vec[mutable node] v = vec(mutable none[uint]); + let vec[mutable node] v = [mutable none[uint]]; _vec::pop(v); // FIXME: botch ret rec(mutable nodes=v); } fn make_set(&ufind ufnd) -> uint { auto idx = _vec::len(ufnd.nodes); - ufnd.nodes += vec(mutable none[uint]); + ufnd.nodes += [mutable none[uint]]; ret idx; } diff --git a/src/lib/win32_os.rs b/src/lib/win32_os.rs index e9555249ed4a..2baed39cac1b 100644 --- a/src/lib/win32_os.rs +++ b/src/lib/win32_os.rs @@ -52,7 +52,7 @@ fn dylib_filename(str base) -> str { } fn pipe() -> tup(int, int) { - let vec[mutable int] fds = vec(mutable 0, 0); + let vec[mutable int] fds = [mutable 0, 0]; assert (os::libc::_pipe(_vec::buf(fds), 1024u, libc_constants::O_BINARY()) == 0); ret tup(fds.(0), fds.(1)); diff --git a/src/snapshots.txt b/src/snapshots.txt index 56e1df2c2e6a..21c73a81d717 100644 --- a/src/snapshots.txt +++ b/src/snapshots.txt @@ -1,4 +1,7 @@ -T +T 2011-05-16 ae030c5 + linux-i386 83a6f52df4029b61ebd628795b0a400265c98179 + macos-i386 1167e8b782165be738cbd08eeab104ede0d61df6 + winnt-i386 456bc38c2bc7ebb27fd008e3ccd05f16f6a31fe6 S 2011-05-12 b1d3364 linux-i386 7671ac0de19d9ea981616b3c58c1d48f1b43820a diff --git a/src/test/bench/shootout/fasta.rs b/src/test/bench/shootout/fasta.rs index ec962e38a481..b7a890971e33 100644 --- a/src/test/bench/shootout/fasta.rs +++ b/src/test/bench/shootout/fasta.rs @@ -28,10 +28,10 @@ type aminoacids = tup(char, u32); fn make_cumulative(vec[aminoacids] aa) -> vec[aminoacids] { let u32 cp = 0u32; - let vec[aminoacids] ans = vec(); + let vec[aminoacids] ans = []; for (aminoacids a in aa) { cp += a._1; - ans += vec(tup(a._0, cp)); + ans += [tup(a._0, cp)]; } ret ans; } @@ -91,7 +91,7 @@ fn make_repeat_fasta(str id, str desc, str s, int n) { } fn main(vec[str] args) { - let vec[aminoacids] iub = make_cumulative(vec(tup( 'a', 27u32 ), + let vec[aminoacids] iub = make_cumulative([tup( 'a', 27u32 ), tup( 'c', 12u32 ), tup( 'g', 12u32 ), tup( 't', 27u32 ), @@ -106,12 +106,12 @@ fn main(vec[str] args) { tup( 'S', 2u32 ), tup( 'V', 2u32 ), tup( 'W', 2u32 ), - tup( 'Y', 2u32 ))); + tup( 'Y', 2u32 )]); - let vec[aminoacids] homosapiens = make_cumulative(vec(tup( 'a', 30u32 ), + let vec[aminoacids] homosapiens = make_cumulative([tup( 'a', 30u32 ), tup( 'c', 20u32 ), tup( 'g', 20u32 ), - tup( 't', 30u32 ))); + tup( 't', 30u32 )]); let str alu = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + diff --git a/src/test/bench/shootout/nbody.rs b/src/test/bench/shootout/nbody.rs index 4b3e9044d923..152291c7145e 100644 --- a/src/test/bench/shootout/nbody.rs +++ b/src/test/bench/shootout/nbody.rs @@ -7,7 +7,7 @@ native "llvm" mod llvm { fn main() { - let vec[int] inputs = vec( + let vec[int] inputs = [ 50000, 500000 // @@ -16,7 +16,7 @@ fn main() { // during 'make check' under valgrind // 5000000 // 50000000 - ); + ]; let vec[Body::props] bodies = NBodySystem::MakeNBodySystem(); @@ -38,13 +38,13 @@ fn main() { mod NBodySystem { fn MakeNBodySystem() -> vec[Body::props] { - let vec[Body::props] bodies = vec( + let vec[Body::props] bodies = [ // these each return a Body::props Body::sun(), Body::jupiter(), Body::saturn(), Body::uranus(), - Body::neptune()); + Body::neptune()]; let float px = 0.0; let float py = 0.0; diff --git a/src/test/compile-fail/infinite-vec-type-recursion.rs b/src/test/compile-fail/infinite-vec-type-recursion.rs index 5e26c855ed69..9a2cd3237ba3 100644 --- a/src/test/compile-fail/infinite-vec-type-recursion.rs +++ b/src/test/compile-fail/infinite-vec-type-recursion.rs @@ -8,5 +8,5 @@ type x = vec[x]; fn main() { - let x b = vec(); + let x b = []; } diff --git a/src/test/compile-fail/writing-to-immutable-vec.rs b/src/test/compile-fail/writing-to-immutable-vec.rs index cb4030eaed73..2872d11fc800 100644 --- a/src/test/compile-fail/writing-to-immutable-vec.rs +++ b/src/test/compile-fail/writing-to-immutable-vec.rs @@ -3,6 +3,6 @@ // xfail-stage2 // error-pattern: writing to immutable type fn main() { - let vec[int] v = vec(1, 2, 3); + let vec[int] v = [1, 2, 3]; v.(1) = 4; } \ No newline at end of file diff --git a/src/test/run-fail/vec-overrun.rs b/src/test/run-fail/vec-overrun.rs index 1eaedff9b4c6..a6d782809c7d 100644 --- a/src/test/run-fail/vec-overrun.rs +++ b/src/test/run-fail/vec-overrun.rs @@ -6,7 +6,7 @@ // error-pattern:bounds check fn main() { - let vec[int] v = vec(10); + let vec[int] v = [10]; let int x = 0; assert (v.(x) == 10); // Bounds-check failure. diff --git a/src/test/run-fail/vec-underrun.rs b/src/test/run-fail/vec-underrun.rs index fab59869d8c9..ac691bb85aed 100644 --- a/src/test/run-fail/vec-underrun.rs +++ b/src/test/run-fail/vec-underrun.rs @@ -6,7 +6,7 @@ // error-pattern:bounds check fn main() { - let vec[int] v = vec(10, 20); + let vec[int] v = [10, 20]; let int x = 0; assert (v.(x) == 10); // Bounds-check failure. diff --git a/src/test/run-pass/alt-join.rs b/src/test/run-pass/alt-join.rs index a785f91d3b44..3d6d6313085d 100644 --- a/src/test/run-pass/alt-join.rs +++ b/src/test/run-pass/alt-join.rs @@ -7,7 +7,7 @@ import std::option::some; fn foo[T](&option::t[T] y) { let int x; - let vec[int] res = vec(); + let vec[int] res = []; /* tests that x doesn't get put in the precondition for the entire if expression */ @@ -22,7 +22,7 @@ fn foo[T](&option::t[T] y) { x = 42; } } - res += vec(x); + res += [x]; } ret; diff --git a/src/test/run-pass/argv.rs b/src/test/run-pass/argv.rs index 92d5fcc6e664..a84d3192f7b9 100644 --- a/src/test/run-pass/argv.rs +++ b/src/test/run-pass/argv.rs @@ -1,6 +1,6 @@ fn main(vec[str] args) { - let vec[str] vs = vec("hi", "there", "this", "is", "a", "vec"); - let vec[vec[str]] vvs = vec(args, vs); + let vec[str] vs = ["hi", "there", "this", "is", "a", "vec"]; + let vec[vec[str]] vvs = [args, vs]; for (vec[str] vs in vvs) { for (str s in vs) { log s; diff --git a/src/test/run-pass/break.rs b/src/test/run-pass/break.rs index 3485977e1325..65f0f57a14ad 100644 --- a/src/test/run-pass/break.rs +++ b/src/test/run-pass/break.rs @@ -13,7 +13,7 @@ fn main() { } while (i < 30); assert (i == 20); - for (int x in vec(1, 2, 3, 4, 5, 6)) { + for (int x in [1, 2, 3, 4, 5, 6]) { if (x == 3) { break; } assert (x <= 3); } @@ -32,7 +32,7 @@ fn main() { assert (i % 2 != 0); } while (i < 10); - for (int x in vec(1, 2, 3, 4, 5, 6)) { + for (int x in [1, 2, 3, 4, 5, 6]) { if (x % 2 == 0) { cont; } assert (x % 2 != 0); } diff --git a/src/test/run-pass/empty-mutable-vec.rs b/src/test/run-pass/empty-mutable-vec.rs index a972fda4e53b..7faf162b8890 100644 --- a/src/test/run-pass/empty-mutable-vec.rs +++ b/src/test/run-pass/empty-mutable-vec.rs @@ -1,4 +1,4 @@ fn main() { - let vec[mutable int] v = vec(mutable); + let vec[mutable int] v = [mutable]; } diff --git a/src/test/run-pass/expr-alt-generic-box2.rs b/src/test/run-pass/expr-alt-generic-box2.rs index 7398d0b030c1..3b6cadc7202a 100644 --- a/src/test/run-pass/expr-alt-generic-box2.rs +++ b/src/test/run-pass/expr-alt-generic-box2.rs @@ -16,7 +16,7 @@ fn test_vec() { ret v1 == v2; } auto eq = bind compare_vec(_, _); - test_generic[vec[int]](vec(1, 2, 3), eq); + test_generic[vec[int]]([1, 2, 3], eq); } fn main() { diff --git a/src/test/run-pass/expr-block-generic-box2.rs b/src/test/run-pass/expr-block-generic-box2.rs index d0e272a26cc1..2c9d85d5d96d 100644 --- a/src/test/run-pass/expr-block-generic-box2.rs +++ b/src/test/run-pass/expr-block-generic-box2.rs @@ -12,7 +12,7 @@ fn test_vec() { ret v1 == v2; } auto eq = bind compare_vec(_, _); - test_generic[vec[int]](vec(1, 2), eq); + test_generic[vec[int]]([1, 2], eq); } fn main() { diff --git a/src/test/run-pass/expr-if-generic-box2.rs b/src/test/run-pass/expr-if-generic-box2.rs index 572662431f67..c0224fffcd21 100644 --- a/src/test/run-pass/expr-if-generic-box2.rs +++ b/src/test/run-pass/expr-if-generic-box2.rs @@ -12,7 +12,7 @@ fn test_vec() { ret v1 == v2; } auto eq = bind compare_vec(_, _); - test_generic[vec[int]](vec(1, 2), vec(2, 3), eq); + test_generic[vec[int]]([1, 2], [2, 3], eq); } fn main() { diff --git a/src/test/run-pass/foreach-nested-2.rs b/src/test/run-pass/foreach-nested-2.rs index 33a376d529e6..423821ab16ca 100644 --- a/src/test/run-pass/foreach-nested-2.rs +++ b/src/test/run-pass/foreach-nested-2.rs @@ -15,7 +15,7 @@ iter range(int start, int stop) -> int { fn main() { let vec[mutable int] a = - vec(mutable -1, -1, -1, -1, -1, -1, -1, -1); + [mutable -1, -1, -1, -1, -1, -1, -1, -1]; let int p = 0; for each (int i in two()) { diff --git a/src/test/run-pass/foreach-nested.rs b/src/test/run-pass/foreach-nested.rs index 9ba304c1463a..dd431a808903 100644 --- a/src/test/run-pass/foreach-nested.rs +++ b/src/test/run-pass/foreach-nested.rs @@ -6,7 +6,7 @@ iter two() -> int { } fn main() { - let vec[mutable int] a = vec(mutable -1, -1, -1, -1); + let vec[mutable int] a = [mutable -1, -1, -1, -1]; let int p = 0; for each (int i in two()) { diff --git a/src/test/run-pass/integral-indexing.rs b/src/test/run-pass/integral-indexing.rs index ee80786c18a4..f7207295685f 100644 --- a/src/test/run-pass/integral-indexing.rs +++ b/src/test/run-pass/integral-indexing.rs @@ -2,7 +2,7 @@ fn main() { - let vec[int] v = vec(0, 1, 2, 3, 4, 5); + let vec[int] v = [0, 1, 2, 3, 4, 5]; let str s = "abcdef"; assert (v.(3u) == 3); assert (v.(3u8) == 3); diff --git a/src/test/run-pass/lib-bitv.rs b/src/test/run-pass/lib-bitv.rs index 506d5b2ad1d0..706f3c22cd58 100644 --- a/src/test/run-pass/lib-bitv.rs +++ b/src/test/run-pass/lib-bitv.rs @@ -16,10 +16,10 @@ fn test_1_element() { auto act; act = bitv::create(1u, false); - assert (bitv::eq_vec(act, vec(0u))); + assert (bitv::eq_vec(act, [0u])); act = bitv::create(1u, true); - assert (bitv::eq_vec(act, vec(1u))); + assert (bitv::eq_vec(act, [1u])); } fn test_10_elements() { @@ -27,11 +27,11 @@ fn test_10_elements() { // all 0 act = bitv::create(10u, false); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u))); + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u])); // all 1 act = bitv::create(10u, true); - assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u))); + assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(10u, false); @@ -40,7 +40,7 @@ fn test_10_elements() { bitv::set(act, 2u, true); bitv::set(act, 3u, true); bitv::set(act, 4u, true); - assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u))); + assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(10u, false); @@ -49,7 +49,7 @@ fn test_10_elements() { bitv::set(act, 7u, true); bitv::set(act, 8u, true); bitv::set(act, 9u, true); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u))); + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(10u, false); @@ -57,7 +57,7 @@ fn test_10_elements() { bitv::set(act, 3u, true); bitv::set(act, 6u, true); bitv::set(act, 9u, true); - assert (bitv::eq_vec(act, vec(1u, 0u, 0u, 1u, 0u, 0u, 1u, 0u, 0u, 1u))); + assert (bitv::eq_vec(act, [1u, 0u, 0u, 1u, 0u, 0u, 1u, 0u, 0u, 1u])); } fn test_31_elements() { @@ -65,17 +65,17 @@ fn test_31_elements() { // all 0 act = bitv::create(31u, false); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u))); + 0u, 0u, 0u, 0u, 0u, 0u, 0u])); // all 1 act = bitv::create(31u, true); - assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 1u, 1u, 1u, 1u, 1u, 1u, 1u))); + 1u, 1u, 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(31u, false); @@ -87,10 +87,10 @@ fn test_31_elements() { bitv::set(act, 5u, true); bitv::set(act, 6u, true); bitv::set(act, 7u, true); - assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u))); + 0u, 0u, 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(31u, false); @@ -102,10 +102,10 @@ fn test_31_elements() { bitv::set(act, 21u, true); bitv::set(act, 22u, true); bitv::set(act, 23u, true); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u))); + 0u, 0u, 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(31u, false); @@ -116,20 +116,20 @@ fn test_31_elements() { bitv::set(act, 28u, true); bitv::set(act, 29u, true); bitv::set(act, 30u, true); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 1u, 1u, 1u, 1u, 1u, 1u, 1u))); + 1u, 1u, 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(31u, false); bitv::set(act, 3u, true); bitv::set(act, 17u, true); bitv::set(act, 30u, true); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 1u))); + 0u, 0u, 0u, 0u, 0u, 0u, 1u])); } fn test_32_elements() { @@ -137,17 +137,17 @@ fn test_32_elements() { // all 0 act = bitv::create(32u, false); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u))); + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u])); // all 1 act = bitv::create(32u, true); - assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u))); + 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(32u, false); @@ -159,10 +159,10 @@ fn test_32_elements() { bitv::set(act, 5u, true); bitv::set(act, 6u, true); bitv::set(act, 7u, true); - assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u))); + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(32u, false); @@ -174,10 +174,10 @@ fn test_32_elements() { bitv::set(act, 21u, true); bitv::set(act, 22u, true); bitv::set(act, 23u, true); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u))); + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(32u, false); @@ -189,10 +189,10 @@ fn test_32_elements() { bitv::set(act, 29u, true); bitv::set(act, 30u, true); bitv::set(act, 31u, true); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u))); + 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(32u, false); @@ -200,10 +200,10 @@ fn test_32_elements() { bitv::set(act, 17u, true); bitv::set(act, 30u, true); bitv::set(act, 31u, true); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u))); + 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u])); } fn test_33_elements() { @@ -211,19 +211,19 @@ fn test_33_elements() { // all 0 act = bitv::create(33u, false); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u))); + 0u])); // all 1 act = bitv::create(33u, true); - assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 1u))); + 1u])); // mixed act = bitv::create(33u, false); @@ -235,11 +235,11 @@ fn test_33_elements() { bitv::set(act, 5u, true); bitv::set(act, 6u, true); bitv::set(act, 7u, true); - assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u))); + 0u])); // mixed act = bitv::create(33u, false); @@ -251,11 +251,11 @@ fn test_33_elements() { bitv::set(act, 21u, true); bitv::set(act, 22u, true); bitv::set(act, 23u, true); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u))); + 0u])); // mixed act = bitv::create(33u, false); @@ -267,11 +267,11 @@ fn test_33_elements() { bitv::set(act, 29u, true); bitv::set(act, 30u, true); bitv::set(act, 31u, true); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 0u))); + 0u])); // mixed act = bitv::create(33u, false); @@ -280,11 +280,11 @@ fn test_33_elements() { bitv::set(act, 30u, true); bitv::set(act, 31u, true); bitv::set(act, 32u, true); - assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, + assert (bitv::eq_vec(act, [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u, - 1u))); + 1u])); } fn main() { diff --git a/src/test/run-pass/lib-io.rs b/src/test/run-pass/lib-io.rs index d9a33a6b120d..3462e93f7c51 100644 --- a/src/test/run-pass/lib-io.rs +++ b/src/test/run-pass/lib-io.rs @@ -14,7 +14,7 @@ fn test_simple(str tmpfilebase) { log frood; { - let io::writer out = io::file_writer(tmpfile, vec(io::create)); + let io::writer out = io::file_writer(tmpfile, [io::create]); out.write_str(frood); } diff --git a/src/test/run-pass/lib-qsort.rs b/src/test/run-pass/lib-qsort.rs index 2f086667686c..473950cd8644 100644 --- a/src/test/run-pass/lib-qsort.rs +++ b/src/test/run-pass/lib-qsort.rs @@ -19,32 +19,32 @@ fn check_sort(vec[mutable int] v1, vec[mutable int] v2) { fn main() { { - auto v1 = vec(mutable 3,7,4,5,2,9,5,8); - auto v2 = vec(mutable 2,3,4,5,5,7,8,9); + auto v1 = [mutable 3,7,4,5,2,9,5,8]; + auto v2 = [mutable 2,3,4,5,5,7,8,9]; check_sort(v1, v2); } { - auto v1 = vec(mutable 1,1,1); - auto v2 = vec(mutable 1,1,1); + auto v1 = [mutable 1,1,1]; + auto v2 = [mutable 1,1,1]; check_sort(v1, v2); } { - let vec[mutable int] v1 = vec(mutable); - let vec[mutable int] v2 = vec(mutable); + let vec[mutable int] v1 = [mutable]; + let vec[mutable int] v2 = [mutable]; check_sort(v1, v2); } { - auto v1 = vec(mutable 9); - auto v2 = vec(mutable 9); + auto v1 = [mutable 9]; + auto v2 = [mutable 9]; check_sort(v1, v2); } { - auto v1 = vec(mutable 9,3,3,3,9); - auto v2 = vec(mutable 3,3,3,9,9); + auto v1 = [mutable 9,3,3,3,9]; + auto v2 = [mutable 3,3,3,9,9]; check_sort(v1, v2); } diff --git a/src/test/run-pass/lib-sha1.rs b/src/test/run-pass/lib-sha1.rs index 882784796d56..7f137cb871c1 100644 --- a/src/test/run-pass/lib-sha1.rs +++ b/src/test/run-pass/lib-sha1.rs @@ -24,44 +24,44 @@ fn main() { // Test messages from FIPS 180-1 let vec[test] fips_180_1_tests = - vec( + [ rec(input = "abc", - output = vec(0xA9u8, 0x99u8, 0x3Eu8, 0x36u8, 0x47u8, + output = [0xA9u8, 0x99u8, 0x3Eu8, 0x36u8, 0x47u8, 0x06u8, 0x81u8, 0x6Au8, 0xBAu8, 0x3Eu8, 0x25u8, 0x71u8, 0x78u8, 0x50u8, 0xC2u8, - 0x6Cu8, 0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8) + 0x6Cu8, 0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8] ), rec(input = "abcdbcdecdefdefgefghfghighij" + "hijkijkljklmklmnlmnomnopnopq", - output = vec(0x84u8, 0x98u8, 0x3Eu8, 0x44u8, 0x1Cu8, + output = [0x84u8, 0x98u8, 0x3Eu8, 0x44u8, 0x1Cu8, 0x3Bu8, 0xD2u8, 0x6Eu8, 0xBAu8, 0xAEu8, 0x4Au8, 0xA1u8, 0xF9u8, 0x51u8, 0x29u8, - 0xE5u8, 0xE5u8, 0x46u8, 0x70u8, 0xF1u8) + 0xE5u8, 0xE5u8, 0x46u8, 0x70u8, 0xF1u8] ), rec(input = a_million_letter_a(), - output = vec(0x34u8, 0xAAu8, 0x97u8, 0x3Cu8, 0xD4u8, + output = [0x34u8, 0xAAu8, 0x97u8, 0x3Cu8, 0xD4u8, 0xC4u8, 0xDAu8, 0xA4u8, 0xF6u8, 0x1Eu8, 0xEBu8, 0x2Bu8, 0xDBu8, 0xADu8, 0x27u8, - 0x31u8, 0x65u8, 0x34u8, 0x01u8, 0x6Fu8) + 0x31u8, 0x65u8, 0x34u8, 0x01u8, 0x6Fu8] ) - ); + ]; // Examples from wikipedia let vec[test] wikipedia_tests = - vec( + [ rec(input = "The quick brown fox jumps over the lazy dog", - output = vec(0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8, 0x7au8, + output = [0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8, 0x7au8, 0x2du8, 0x28u8, 0xfcu8, 0xedu8, 0x84u8, 0x9eu8, 0xe1u8, 0xbbu8, 0x76u8, 0xe7u8, - 0x39u8, 0x1bu8, 0x93u8, 0xebu8, 0x12u8) + 0x39u8, 0x1bu8, 0x93u8, 0xebu8, 0x12u8] ), rec(input = "The quick brown fox jumps over the lazy cog", - output = vec(0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8, 0xd2u8, + output = [0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8, 0xd2u8, 0x5eu8, 0x1bu8, 0x3au8, 0xfau8, 0xd3u8, 0xe8u8, 0x5au8, 0x0bu8, 0xd1u8, 0x7du8, - 0x9bu8, 0x10u8, 0x0du8, 0xb4u8, 0xb3u8) + 0x9bu8, 0x10u8, 0x0du8, 0xb4u8, 0xb3u8] ) - ); + ]; auto tests = fips_180_1_tests + wikipedia_tests; diff --git a/src/test/run-pass/lib-sort.rs b/src/test/run-pass/lib-sort.rs index 6ec266fa2108..fe0c9e9473fb 100644 --- a/src/test/run-pass/lib-sort.rs +++ b/src/test/run-pass/lib-sort.rs @@ -17,32 +17,32 @@ fn check_sort(vec[int] v1, vec[int] v2) { fn main() { { - auto v1 = vec(3,7,4,5,2,9,5,8); - auto v2 = vec(2,3,4,5,5,7,8,9); + auto v1 = [3,7,4,5,2,9,5,8]; + auto v2 = [2,3,4,5,5,7,8,9]; check_sort(v1, v2); } { - auto v1 = vec(1,1,1); - auto v2 = vec(1,1,1); + auto v1 = [1,1,1]; + auto v2 = [1,1,1]; check_sort(v1, v2); } { - let vec[int] v1 = vec(); - let vec[int] v2 = vec(); + let vec[int] v1 = []; + let vec[int] v2 = []; check_sort(v1, v2); } { - auto v1 = vec(9); - auto v2 = vec(9); + auto v1 = [9]; + auto v2 = [9]; check_sort(v1, v2); } { - auto v1 = vec(9,3,3,3,9); - auto v2 = vec(3,3,3,9,9); + auto v1 = [9,3,3,3,9]; + auto v2 = [3,3,3,9,9]; check_sort(v1, v2); } diff --git a/src/test/run-pass/lib-str.rs b/src/test/run-pass/lib-str.rs index eaa31012b11d..185694a25a1b 100644 --- a/src/test/run-pass/lib-str.rs +++ b/src/test/run-pass/lib-str.rs @@ -73,10 +73,10 @@ fn test_concat() { assert (_str::eq(_str::concat(v), s)); } - t(vec("you", "know", "I'm", "no", "good"), "youknowI'mnogood"); - let vec[str] v = vec(); + t(["you", "know", "I'm", "no", "good"], "youknowI'mnogood"); + let vec[str] v = []; t(v, ""); - t(vec("hi"), "hi"); + t(["hi"], "hi"); } fn test_connect() { @@ -84,10 +84,10 @@ fn test_connect() { assert (_str::eq(_str::connect(v, sep), s)); } - t(vec("you", "know", "I'm", "no", "good"), " ", "you know I'm no good"); - let vec[str] v = vec(); + t(["you", "know", "I'm", "no", "good"], " ", "you know I'm no good"); + let vec[str] v = []; t(v, " ", ""); - t(vec("hi"), " ", "hi"); + t(["hi"], " ", "hi"); } fn test_to_upper() { diff --git a/src/test/run-pass/lib-vec.rs b/src/test/run-pass/lib-vec.rs index f7e6157a14d5..63e903d2d8eb 100644 --- a/src/test/run-pass/lib-vec.rs +++ b/src/test/run-pass/lib-vec.rs @@ -23,7 +23,7 @@ fn test_init_fn() { } fn test_slice() { - let vec[int] v = vec(1,2,3,4,5); + let vec[int] v = [1,2,3,4,5]; auto v2 = std::_vec::slice[int](v, 2u, 4u); assert (std::_vec::len[int](v2) == 2u); assert (v2.(0) == 3); @@ -33,7 +33,7 @@ fn test_slice() { fn test_map() { fn square(&int x) -> int { ret x * x; } let std::option::operator[int, int] op = square; - let vec[int] v = vec(1, 2, 3, 4, 5); + let vec[int] v = [1, 2, 3, 4, 5]; let vec[int] s = std::_vec::map[int, int](op, v); let int i = 0; while (i < 5) { @@ -45,8 +45,8 @@ fn test_map() { fn test_map2() { fn times(&int x, &int y) -> int { ret x * y; } auto f = times; - auto v0 = vec(1, 2, 3, 4, 5); - auto v1 = vec(5, 4, 3, 2, 1); + auto v0 = [1, 2, 3, 4, 5]; + auto v1 = [5, 4, 3, 2, 1]; auto u = std::_vec::map2[int,int,int](f, v0, v1); auto i = 0; diff --git a/src/test/run-pass/linear-for-loop.rs b/src/test/run-pass/linear-for-loop.rs index c816f817225d..6345e43acf51 100644 --- a/src/test/run-pass/linear-for-loop.rs +++ b/src/test/run-pass/linear-for-loop.rs @@ -1,5 +1,5 @@ fn main() { - auto x = vec(1,2,3); + auto x = [1,2,3]; auto y = 0; for (int i in x) { log i; diff --git a/src/test/run-pass/maybe-mutable.rs b/src/test/run-pass/maybe-mutable.rs index c0af0867faa5..7b8781d2f81e 100644 --- a/src/test/run-pass/maybe-mutable.rs +++ b/src/test/run-pass/maybe-mutable.rs @@ -9,9 +9,9 @@ fn len(vec[mutable? int] v) -> uint { } fn main() { - auto v0 = vec(1, 2, 3, 4, 5); + auto v0 = [1, 2, 3, 4, 5]; log len(v0); - auto v1 = vec(mutable 1, 2, 3, 4, 5); + auto v1 = [mutable 1, 2, 3, 4, 5]; log len(v1); } diff --git a/src/test/run-pass/mutable-alias-vec.rs b/src/test/run-pass/mutable-alias-vec.rs index c63220dfbfa9..a09d8dc4ab8a 100644 --- a/src/test/run-pass/mutable-alias-vec.rs +++ b/src/test/run-pass/mutable-alias-vec.rs @@ -3,11 +3,11 @@ use std; fn grow(&mutable vec[int] v) { - v += vec(1); + v += [1]; } fn main() { - let vec[int] v = vec(); + let vec[int] v = []; grow(v); grow(v); grow(v); diff --git a/src/test/run-pass/mutable-vec-drop.rs b/src/test/run-pass/mutable-vec-drop.rs index ebfb8c6c53fe..15c36f46b688 100644 --- a/src/test/run-pass/mutable-vec-drop.rs +++ b/src/test/run-pass/mutable-vec-drop.rs @@ -2,5 +2,5 @@ fn main() { // This just tests whether the vec leaks its members. let vec[mutable @tup(int,int)] pvec = - vec(mutable @tup(1,2), @tup(3,4), @tup(5,6)); + [mutable @tup(1,2), @tup(3,4), @tup(5,6)]; } diff --git a/src/test/run-pass/obj-with-vec.rs b/src/test/run-pass/obj-with-vec.rs index b298f75f969f..7b807b9a76f6 100644 --- a/src/test/run-pass/obj-with-vec.rs +++ b/src/test/run-pass/obj-with-vec.rs @@ -5,7 +5,7 @@ fn main() { ret data.(i); } } - auto b = buf(vec(1 as u8, 2 as u8, 3 as u8)); + auto b = buf([1 as u8, 2 as u8, 3 as u8]); log b.get(1); assert (b.get(1) == (2 as u8)); } diff --git a/src/test/run-pass/seq-compare.rs b/src/test/run-pass/seq-compare.rs index ba7e623908d4..9a8eca74af47 100644 --- a/src/test/run-pass/seq-compare.rs +++ b/src/test/run-pass/seq-compare.rs @@ -3,13 +3,13 @@ fn main() { assert ("hello " > "hello"); assert ("hello" != "there"); - assert (vec(1,2,3,4) > vec(1,2,3)); - assert (vec(1,2,3) < vec(1,2,3,4)); - assert (vec(1,2,4,4) > vec(1,2,3,4)); - assert (vec(1,2,3,4) < vec(1,2,4,4)); - assert (vec(1,2,3) <= vec(1,2,3)); - assert (vec(1,2,3) <= vec(1,2,3,3)); - assert (vec(1,2,3,4) > vec(1,2,3)); - assert (vec(1,2,3) == vec(1,2,3)); - assert (vec(1,2,3) != vec(1,1,3)); + assert ([1,2,3,4] > [1,2,3]); + assert ([1,2,3] < [1,2,3,4]); + assert ([1,2,4,4] > [1,2,3,4]); + assert ([1,2,3,4] < [1,2,4,4]); + assert ([1,2,3] <= [1,2,3]); + assert ([1,2,3] <= [1,2,3,3]); + assert ([1,2,3,4] > [1,2,3]); + assert ([1,2,3] == [1,2,3]); + assert ([1,2,3] != [1,1,3]); } diff --git a/src/test/run-pass/size-and-align.rs b/src/test/run-pass/size-and-align.rs index 58d529e8374d..8412d51d8c76 100644 --- a/src/test/run-pass/size-and-align.rs +++ b/src/test/run-pass/size-and-align.rs @@ -13,6 +13,6 @@ fn uhoh[T](vec[clam[T]] v) { } fn main() { - let vec[clam[int]] v = vec(b[int], b[int], a[int](42, 17)); + let vec[clam[int]] v = [b[int], b[int], a[int](42, 17)]; uhoh[int](v); } diff --git a/src/test/run-pass/task-comm-16.rs b/src/test/run-pass/task-comm-16.rs index 9438f50ef4d4..9a533bca036f 100644 --- a/src/test/run-pass/task-comm-16.rs +++ b/src/test/run-pass/task-comm-16.rs @@ -22,7 +22,7 @@ fn test_rec() { fn test_vec() { let port[vec[int]] po = port(); let chan[vec[int]] ch = chan(po); - let vec[int] v0 = vec(0, 1, 2); + let vec[int] v0 = [0, 1, 2]; ch <| v0; diff --git a/src/test/run-pass/task-comm-2.rs b/src/test/run-pass/task-comm-2.rs index f2aa250c8819..e856f0bbef2c 100644 --- a/src/test/run-pass/task-comm-2.rs +++ b/src/test/run-pass/task-comm-2.rs @@ -21,13 +21,13 @@ fn test00(bool create_threads) { let int number_of_tasks = 8; let int i = 0; - let vec[task] tasks = vec(); + let vec[task] tasks = []; while (i < number_of_tasks) { i = i + 1; if (create_threads) { - tasks += vec(spawn thread start(i)); + tasks += [spawn thread start(i)]; } else { - tasks += vec(spawn start(i)); + tasks += [spawn start(i)]; } } diff --git a/src/test/run-pass/task-comm-3.rs b/src/test/run-pass/task-comm-3.rs index 0cdbe5ac0ba7..907a7f280353 100644 --- a/src/test/run-pass/task-comm-3.rs +++ b/src/test/run-pass/task-comm-3.rs @@ -31,13 +31,13 @@ fn test00(bool is_multithreaded) { let int i = 0; // Create and spawn tasks... - let vec[task] tasks = vec(); + let vec[task] tasks = []; while (i < number_of_tasks) { if (is_multithreaded) { - tasks += vec( - spawn thread test00_start(ch, i, number_of_messages)); + tasks += [ + spawn thread test00_start(ch, i, number_of_messages)]; } else { - tasks += vec(spawn test00_start(ch, i, number_of_messages)); + tasks += [spawn test00_start(ch, i, number_of_messages)]; } i = i + 1; } diff --git a/src/test/run-pass/task-comm.rs b/src/test/run-pass/task-comm.rs index 16fc64523822..826743d0937f 100644 --- a/src/test/run-pass/task-comm.rs +++ b/src/test/run-pass/task-comm.rs @@ -33,14 +33,14 @@ fn test00(bool is_multithreaded) { let int i = 0; - let vec[task] tasks = vec(); + let vec[task] tasks = []; while (i < number_of_tasks) { i = i + 1; if (is_multithreaded) { - tasks += vec( - spawn thread test00_start(ch, i, number_of_messages)); + tasks += [ + spawn thread test00_start(ch, i, number_of_messages)]; } else { - tasks += vec(spawn test00_start(ch, i, number_of_messages)); + tasks += [spawn test00_start(ch, i, number_of_messages)]; } } @@ -147,11 +147,11 @@ fn test06() { let int i = 0; - let vec[task] tasks = vec(); + let vec[task] tasks = []; while (i < number_of_tasks) { i = i + 1; - tasks += vec(spawn thread test06_start(i)); - // tasks += vec(spawn test06_start(i)); + tasks += [spawn thread test06_start(i)]; + // tasks += [spawn test06_start(i)]; } for (task t in tasks) { diff --git a/src/test/run-pass/type-params-in-for-each.rs b/src/test/run-pass/type-params-in-for-each.rs index 49fe099b6257..1394643929e7 100644 --- a/src/test/run-pass/type-params-in-for-each.rs +++ b/src/test/run-pass/type-params-in-for-each.rs @@ -9,7 +9,7 @@ iter range(uint lo, uint hi) -> uint { fn create_index[T](vec[tup(T, uint)] index, fn(&T) -> uint hash_fn) { for each (uint i in range(0u, 256u)) { - let vec[T] bucket = vec(); + let vec[T] bucket = []; } } diff --git a/src/test/run-pass/utf8_chars.rs b/src/test/run-pass/utf8_chars.rs index a79294ec5727..22a97ed70020 100644 --- a/src/test/run-pass/utf8_chars.rs +++ b/src/test/run-pass/utf8_chars.rs @@ -8,7 +8,7 @@ import std::io; fn main() { // Chars of 1, 2, 3, and 4 bytes - let vec[char] chs = vec('e', 'é', '€', 0x10000 as char); + let vec[char] chs = ['e', 'é', '€', 0x10000 as char]; let str s = _str::from_chars(chs); assert (_str::byte_len(s) == 10u); @@ -19,9 +19,9 @@ fn main() { assert (_str::char_at(s, 1u) == 'é'); assert (_str::is_utf8(_str::bytes(s))); - assert (!_str::is_utf8(vec(0x80_u8))); - assert (!_str::is_utf8(vec(0xc0_u8))); - assert (!_str::is_utf8(vec(0xc0_u8, 0x10_u8))); + assert (!_str::is_utf8([0x80_u8])); + assert (!_str::is_utf8([0xc0_u8])); + assert (!_str::is_utf8([0xc0_u8, 0x10_u8])); auto stack = "a×c€"; assert (_str::pop_char(stack) == '€'); diff --git a/src/test/run-pass/vec-alloc-append.rs b/src/test/run-pass/vec-alloc-append.rs index d0ca6ab9c8c4..c61d4cc967ba 100644 --- a/src/test/run-pass/vec-alloc-append.rs +++ b/src/test/run-pass/vec-alloc-append.rs @@ -13,5 +13,5 @@ fn slice[T](vec[T] e) { } fn main() { - slice[str](vec("a")); + slice[str](["a"]); } diff --git a/src/test/run-pass/vec-append.rs b/src/test/run-pass/vec-append.rs index dc36799bce4e..1d0d2509570b 100644 --- a/src/test/run-pass/vec-append.rs +++ b/src/test/run-pass/vec-append.rs @@ -13,8 +13,8 @@ import std::_vec; const uint const_refcount = 0x7bad_face_u; fn fast_growth() { - let vec[int] v = vec(1,2,3,4,5); - v += vec(6,7,8,9,0); + let vec[int] v = [1,2,3,4,5]; + v += [6,7,8,9,0]; log v.(9); assert (v.(0) == 1); @@ -23,9 +23,9 @@ fn fast_growth() { } fn slow_growth() { - let vec[int] v = vec(); + let vec[int] v = []; let vec[int] u = v; - v += vec(17); + v += [17]; log v.(0); assert (v.(0) == 17); @@ -34,7 +34,7 @@ fn slow_growth() { fn slow_growth2_helper(str s) { // ref up: s obj acc(vec[str] v) { - fn add(&str s) { v += vec(s); } + fn add(&str s) { v += [s]; } } let str ss = s; // ref up: s @@ -50,7 +50,7 @@ fn slow_growth2_helper(str s) { // ref up: s * copy of existing elements should increment the ref count of * mumble, the existing str in the originally- shared vec. */ - let vec[str] v = vec(mumble); // ref up: v, mumble + let vec[str] v = [mumble]; // ref up: v, mumble let acc a = acc(v); // ref up: a, v log _vec::refcount[str](v); diff --git a/src/test/run-pass/vec-concat.rs b/src/test/run-pass/vec-concat.rs index 09a95402e65f..3ef6b1dec560 100644 --- a/src/test/run-pass/vec-concat.rs +++ b/src/test/run-pass/vec-concat.rs @@ -1,8 +1,8 @@ // -*- rust -*- fn main() { - let vec[int] a = vec(1,2,3,4,5); - let vec[int] b = vec(6,7,8,9,0); + let vec[int] a = [1,2,3,4,5]; + let vec[int] b = [6,7,8,9,0]; let vec[int] v = a + b; log v.(9); assert (v.(0) == 1); diff --git a/src/test/run-pass/vec-drop.rs b/src/test/run-pass/vec-drop.rs index fff9a1ee64bb..6b46102faf4f 100644 --- a/src/test/run-pass/vec-drop.rs +++ b/src/test/run-pass/vec-drop.rs @@ -1,4 +1,4 @@ fn main() { // This just tests whether the vec leaks its members. - let vec[@tup(int,int)] pvec = vec(@tup(1,2),@tup(3,4),@tup(5,6)); + let vec[@tup(int,int)] pvec = [@tup(1,2),@tup(3,4),@tup(5,6)]; } diff --git a/src/test/run-pass/vec-growth.rs b/src/test/run-pass/vec-growth.rs index b6976abd3a92..3c010e19e913 100644 --- a/src/test/run-pass/vec-growth.rs +++ b/src/test/run-pass/vec-growth.rs @@ -1,9 +1,9 @@ fn main() { - auto v = vec(1); - v += vec(2); - v += vec(3); - v += vec(4); - v += vec(5); + auto v = [1]; + v += [2]; + v += [3]; + v += [4]; + v += [5]; assert (v.(0) == 1); assert (v.(1) == 2); assert (v.(2) == 3); diff --git a/src/test/run-pass/vec-in-tup.rs b/src/test/run-pass/vec-in-tup.rs index 415554dd374f..e1c0a78bd9af 100644 --- a/src/test/run-pass/vec-in-tup.rs +++ b/src/test/run-pass/vec-in-tup.rs @@ -1,4 +1,4 @@ fn main() { - let tup(mutable vec[int]) i = tup(mutable vec(1,2,3)); - i._0 = vec(4,5,6); + let tup(mutable vec[int]) i = tup(mutable [1,2,3]); + i._0 = [4,5,6]; } diff --git a/src/test/run-pass/vec-late-init.rs b/src/test/run-pass/vec-late-init.rs index 39a0b6e89bc1..48e91dcd213c 100644 --- a/src/test/run-pass/vec-late-init.rs +++ b/src/test/run-pass/vec-late-init.rs @@ -1,9 +1,9 @@ fn main() { let vec[int] later; if (true) { - later = vec(1); + later = [1]; } else { - later = vec(2); + later = [2]; } log later.(0); } \ No newline at end of file diff --git a/src/test/run-pass/vec-push.rs b/src/test/run-pass/vec-push.rs index fc4f19eae339..09416d67fef0 100644 --- a/src/test/run-pass/vec-push.rs +++ b/src/test/run-pass/vec-push.rs @@ -1,9 +1,9 @@ fn push[T](&mutable vec[mutable? T] v, &T t) { - v += vec(t); + v += [t]; } fn main() { - auto v = @vec(1, 2, 3); + auto v = @[1, 2, 3]; push[int](*v, 1); } diff --git a/src/test/run-pass/vec-ref-count.rs b/src/test/run-pass/vec-ref-count.rs index 86ba642b61f6..cb26e4845d5e 100644 --- a/src/test/run-pass/vec-ref-count.rs +++ b/src/test/run-pass/vec-ref-count.rs @@ -2,7 +2,7 @@ use std; import std::_vec; fn main() { - auto v = vec(1, 2, 3); + auto v = [1, 2, 3]; log_err _vec::refcount[int](v); log_err _vec::refcount[int](v); log_err _vec::refcount[int](v); diff --git a/src/test/run-pass/vec-slice.rs b/src/test/run-pass/vec-slice.rs index dc15060bafe7..fb60210fbfca 100644 --- a/src/test/run-pass/vec-slice.rs +++ b/src/test/run-pass/vec-slice.rs @@ -2,7 +2,7 @@ // xfail-stage1 // xfail-stage2 fn main() { - let vec[int] v = vec(1,2,3,4,5); + let vec[int] v = [1,2,3,4,5]; auto v2 = v.(1,2); assert (v2.(0) == 2); assert (v2.(1) == 3); diff --git a/src/test/run-pass/vec.rs b/src/test/run-pass/vec.rs index 138d0ff2880a..5e97fa81465a 100644 --- a/src/test/run-pass/vec.rs +++ b/src/test/run-pass/vec.rs @@ -1,7 +1,7 @@ // -*- rust -*- fn main() { - let vec[int] v = vec(10, 20); + let vec[int] v = [10, 20]; assert (v.(0) == 10); assert (v.(1) == 20); let int x = 0; diff --git a/src/test/run-pass/while-with-break.rs b/src/test/run-pass/while-with-break.rs index 2adaf24bbc38..64dc59af3d68 100644 --- a/src/test/run-pass/while-with-break.rs +++ b/src/test/run-pass/while-with-break.rs @@ -6,7 +6,7 @@ fn main() { log i; i = i + 1; if (i == 95) { - let vec[int] v = vec(1,2,3,4,5); // we check that it is freed by break + let vec[int] v = [1,2,3,4,5]; // we check that it is freed by break log "breaking"; break; }