rewrite of shootout-fasta.rs

improvements:
 - no managed box
 - no virtual calls
 - no useless copy
 - optimizations (bisect is slower, limit tests, BufferedWriter...)
 - pass shootout test
 - should be as fast as the best official test

Thanks to @cmr and @eddyb for their help!
This commit is contained in:
Guillaume Pinot 2013-12-12 12:26:56 +01:00
parent d441c54688
commit 64ca0ba6e9

View file

@ -8,148 +8,116 @@
// option. This file may not be copied, modified, or distributed
// except according to those terms.
#[feature(managed_boxes)];
/* -*- mode: rust; indent-tabs-mode: nil -*-
* Implementation of 'fasta' benchmark from
* Computer Language Benchmarks Game
* http://shootout.alioth.debian.org/
*/
extern mod extra;
use std::int;
use std::io;
use std::io::buffered::BufferedWriter;
use std::io::File;
use std::num::min;
use std::os;
use std::rand::Rng;
use std::rand;
use std::str;
static LINE_LENGTH: uint = 60u;
static LINE_LENGTH: uint = 60;
static IM: u32 = 139968;
struct MyRandom {
last: u32
}
fn myrandom_next(r: @mut MyRandom, mx: u32) -> u32 {
r.last = (r.last * 3877u32 + 29573u32) % 139968u32;
mx * r.last / 139968u32
}
#[deriving(Clone)]
struct AminoAcids {
ch: char,
prob: u32
}
fn make_cumulative(aa: ~[AminoAcids]) -> ~[AminoAcids] {
let mut cp: u32 = 0u32;
let mut ans: ~[AminoAcids] = ~[];
for a in aa.iter() {
cp += a.prob;
ans.push(AminoAcids {ch: a.ch, prob: cp});
impl MyRandom {
fn new() -> MyRandom { MyRandom { last: 42 } }
fn normalize(p: f32) -> u32 {(p * IM as f32).floor() as u32}
fn gen(&mut self) -> u32 {
self.last = (self.last * 3877 + 29573) % IM;
self.last
}
ans
}
fn select_random(r: u32, genelist: ~[AminoAcids]) -> char {
if r < genelist[0].prob { return genelist[0].ch; }
fn bisect(v: ~[AminoAcids], lo: uint, hi: uint, target: u32) -> char {
if hi > lo + 1u {
let mid: uint = lo + (hi - lo) / 2u;
if target < v[mid].prob {
return bisect(v, lo, mid, target);
} else {
return bisect(v, mid, hi, target);
}
} else {
return v[hi].ch;
struct AAGen<'a> {
rng: &'a mut MyRandom,
data: ~[(u32, u8)]
}
impl<'a> AAGen<'a> {
fn new<'b>(rng: &'b mut MyRandom, aa: &[(char, f32)]) -> AAGen<'b> {
let mut cum = 0.;
let data = aa.iter()
.map(|&(ch, p)| { cum += p; (MyRandom::normalize(cum), ch as u8) })
.collect();
AAGen { rng: rng, data: data }
}
}
impl<'a> Iterator<u8> for AAGen<'a> {
fn next(&mut self) -> Option<u8> {
let r = self.rng.gen();
self.data.iter()
.skip_while(|pc| pc.n0() < r)
.map(|&(_, c)| c)
.next()
}
}
fn make_fasta<W: Writer, I: Iterator<u8>>(
wr: &mut W, header: &str, mut it: I, mut n: uint)
{
wr.write(header.as_bytes());
let mut line = [0u8, .. LINE_LENGTH + 1];
while n > 0 {
let nb = min(LINE_LENGTH, n);
for i in range(0, nb) {
line[i] = it.next().unwrap();
}
n -= nb;
line[nb] = '\n' as u8;
wr.write(line.slice_to(nb + 1));
}
bisect(genelist.clone(), 0, genelist.len() - 1, r)
}
fn make_random_fasta(wr: @mut io::Writer,
id: ~str,
desc: ~str,
genelist: ~[AminoAcids],
n: int) {
writeln!(wr, ">{} {}", id, desc);
let mut rng = rand::rng();
let rng = @mut MyRandom {
last: rng.gen()
fn run<W: Writer>(writer: &mut W) {
let args = os::args();
let n = if os::getenv("RUST_BENCH").is_some() {
25000000
} else if args.len() <= 1u {
1000
} else {
from_str(args[1]).unwrap()
};
let mut op: ~str = ~"";
for _ in range(0u, n as uint) {
op.push_char(select_random(myrandom_next(rng, 100u32),
genelist.clone()));
if op.len() >= LINE_LENGTH {
writeln!(wr, "{}", op);
op = ~"";
}
}
if op.len() > 0u { writeln!(wr, "{}", op); }
}
fn make_repeat_fasta(wr: @mut io::Writer, id: ~str, desc: ~str, s: ~str, n: int) {
writeln!(wr, ">{} {}", id, desc);
let mut op = str::with_capacity( LINE_LENGTH );
let sl = s.len();
for i in range(0u, n as uint) {
if (op.len() >= LINE_LENGTH) {
writeln!(wr, "{}", op);
op = str::with_capacity( LINE_LENGTH );
}
op.push_char( s[i % sl] as char );
}
if op.len() > 0 {
writeln!(wr, "{}", op);
}
}
let rng = &mut MyRandom::new();
let alu =
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\
GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\
CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\
ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\
GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
let iub = &[('a', 0.27), ('c', 0.12), ('g', 0.12),
('t', 0.27), ('B', 0.02), ('D', 0.02),
('H', 0.02), ('K', 0.02), ('M', 0.02),
('N', 0.02), ('R', 0.02), ('S', 0.02),
('V', 0.02), ('W', 0.02), ('Y', 0.02)];
let homosapiens = &[('a', 0.3029549426680),
('c', 0.1979883004921),
('g', 0.1975473066391),
('t', 0.3015094502008)];
fn acid(ch: char, prob: u32) -> AminoAcids {
AminoAcids {ch: ch, prob: prob}
make_fasta(writer, ">ONE Homo sapiens alu\n",
alu.as_bytes().iter().cycle().map(|c| *c), n * 2);
make_fasta(writer, ">TWO IUB ambiguity codes\n",
AAGen::new(rng, iub), n * 3);
make_fasta(writer, ">THREE Homo sapiens frequency\n",
AAGen::new(rng, homosapiens), n * 5);
writer.flush();
}
fn main() {
let args = os::args();
let args = if os::getenv("RUST_BENCH").is_some() {
// alioth tests k-nucleotide with this data at 25,000,000
~[~"", ~"5000000"]
} else if args.len() <= 1u {
~[~"", ~"1000"]
if os::getenv("RUST_BENCH").is_some() {
let mut file = BufferedWriter::new(File::create(&Path::new("./shootout-fasta.data")));
run(&mut file);
} else {
args
};
let writer = if os::getenv("RUST_BENCH").is_some() {
let file = File::create(&Path::new("./shootout-fasta.data"));
@mut file as @mut io::Writer
} else {
@mut io::stdout() as @mut io::Writer
};
let n = from_str::<int>(args[1]).unwrap();
let iub: ~[AminoAcids] =
make_cumulative(~[acid('a', 27u32), acid('c', 12u32), acid('g', 12u32),
acid('t', 27u32), acid('B', 2u32), acid('D', 2u32),
acid('H', 2u32), acid('K', 2u32), acid('M', 2u32),
acid('N', 2u32), acid('R', 2u32), acid('S', 2u32),
acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]);
let homosapiens: ~[AminoAcids] =
make_cumulative(~[acid('a', 30u32), acid('c', 20u32), acid('g', 20u32),
acid('t', 30u32)]);
let alu: ~str =
~"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\
GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\
CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\
ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\
GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
make_repeat_fasta(writer, ~"ONE", ~"Homo sapiens alu", alu, n * 2);
make_random_fasta(writer, ~"TWO", ~"IUB ambiguity codes", iub, n * 3);
make_random_fasta(writer, ~"THREE",
~"Homo sapiens frequency", homosapiens, n * 5);
run(&mut BufferedWriter::new(io::stdout()));
}
}